Journal articles: 'United States. National Service Corps (Proposed)' – Grafiati (2024)

Abstract:

The National Youth Service Corps was established under Decree 24 of 1973 to foster national unity. It was one of the post-civil war strategies of reconciling the warring groups and building a united Nigeria. At its inception, the programme was generally well received, however as time progressed, some destabilizing factors began to dim the hope of its continuity. This study therefore aims at investigating to what extent the National Youth Service Corps programme will remain a viable instrument of national integration in the coming years. Using the quantitative research orientation, 400 copies of a questionnaire were administered among current participants, former participants, prospective participants as well as non-participants across four (4) Local Government Areas in Lagos and Ogun States. A total of 345 completed questionnaires were returned, giving a rate of return of 86.25%. The analysis of the data was essentially by descriptive statistical methods including, frequency tables and simple percentile. The result suggests that the National Youth Service Corp programme is currently being threatened by the twin challenges of insecurity and youth unemployment. 49.4% of respondents opined that they influenced their postings due to security issues, while 29.3% influenced theirs based on job placement. 63.7% confirmed that there will no need of influencing their postings if the challenges of security and unemployment were resolved. The study therefore recommends that government at all levels do the needful to mitigate these challenges, if the dream of a united Nigeria will be realized.

Abstract:

AbstractThe Urban Archaeology Corps is a United States National Park Service (NPS) work program that invites youth to reflect on archaeological stewardship through digital media. Youth from communities surrounding urban national parks engage in interdisciplinary research, then create short digital movies and video diaries about their experiences. Emphasis is placed on connecting untold stories with the youth and local people. This paper is a case study in building capacity in youth programs for co-created archaeology work experiences and digital products that enable the NPS and the communities it serves to share in archaeological stewardship.

Abstract:

AbstractThis article uses new archival evidence and the growing literature on religion and the foreign relations of the United States to reinterpret the Peace Corps. The religious revival of the 1950s continued into the 1960s, and the Kennedy administration saw ‘spiritual values’ as part of the national interest. Church–state politics and Kennedy's public conception of the role of religion in foreign relations dictated that this aspect of the cold war would change in form. The Peace Corps should, in part, be seen as a continuation of the religious cold war, one that drew on the precedents of missionary and church-service organizations. The Corps was a counterpart to church groups working abroad, and hoped to subcontract much of its work to them. Kennedy hoped to work with religious groups in ecumenical fashion. As Catholic organizations were most visibly interested in receiving Corps funds, funding church groups proved politically unworkable, leading to church–state arguments that Kennedy wanted to avoid. The Kennedy administration struggled to separate the secular and the sacred, as confused definitions of ‘religion’ and a tough constitutional stance narrowed policy options. The Peace Corps fight shaped, and was shaped by, contemporary debates over church and state.

Abstract:

AbstractThis article traces the personal and institutional networks that facilitated the transnational spread of Development Volunteering in the 1950s and 1960s. Examining Australia’s Volunteer Graduate Scheme, Britain’s Voluntary Service Overseas, and the United States Peace Corps, it destabilizes each nation’s claims to pioneering Development Volunteering, and interrogates the reasons for these claims. Once national frames are removed, broader patterns come into view. This article reveals that Development Volunteering held multiple meanings, as discourses of development, colonialism, and control existed alongside those of youthful idealism and national benevolence. It argues that, by involving ‘ordinary’ people in international development and by re-inscribing colonial-era divisions between the developed and developing worlds, Development Volunteering contributed to the broader process by which colonial discourses were translated into the postcolonial lexicon of development.

Abstract:

Several recent oil spills in the United States have had the potential to impact large numbers and multiple populations of cetaceans (whales and dolphins) and pinnipeds (seals and sea lions), namely the Macondo-252/Deepwater Horizon oil spill from April 2010, the Texas City Y event in March 2014, and the Refugio Beach oil spill in May 2015. In each of these spills, the National Oceanic and Atmospheric Administration (NOAA) and partners have engaged in significant activities during and following the spills, to both respond effectively to minimize impacts and assess the effects of oil spills on marine mammals. Experience gained during these spills has led to improved preparedness for future events with potential involvement of marine mammals. NOAA's National Marine Fisheries Service (NMFS) has developed the “National Pinniped and Cetacean Oil Spill Response Guidelines,” which are available online. These guidelines provide a broad national overview of response activities, a proposed organizational structure, and considerations to identify, recover, treat, and sample oiled and potentially oiled marine mammals. Further development of a response framework includes regional preparedness plans for marine mammals, based on the national guidelines but with regionally appropriate modifications to reflect local considerations, including species likely to be impacted, geographic concerns, and understanding of local cultural practices. Efforts are underway to improve training opportunities through a national exercise plan and to track trained and qualified individuals for potential deployment. For assessment, NMFS and NOAA's National Ocean Service (NOS) have partnered to develop the “National Marine Mammal Oil Spill Assessment Guidelines” to facilitate early, efficient, and effective assessment of impacts from oil spills on marine mammals as part of the Natural Resource Damage Assessment process. This paper will outline the current status of these products and their role in marine mammal assessment and response in the U.S., raise awareness of marine mammals within oil spills, and identify potential resources for marine mammal response and assessment in other countries.

Abstract:

AbstractIn 2009, the National Operational Wave Observation Plan, prepared for the U.S. Integrated Ocean Observing System (IOOS®) and led by the National Data Buoy Center and the United States Army Corps of Engineers (USACE), outlined a comprehensive plan that will serve as a basis for a nationwide, high-quality surface-wave monitoring network. One of the projects that the USACE and the California Department of Boating and Waterways cooperatively funds is the Coastal Data Information Program (CDIP). The CDIP is based at the Scripps Institution of Oceanography with its main focus on high-resolution directional wave measurements. The CDIP serves as one of the USACE’s contributions toward IOOS, thus promoting sustained and quality wave measurements throughout the United States.This article describes examples of how reliable, accurate wave data serve the maritime community and coastal managers. Several of the CDIP buoys are moored at the entrances to ports and harbors or close to the nearshore where waves impact the coastal zone. As evident, each port or harbor has unique conditions and therefore its own set of challenges. Specific examples are demonstrated as to how CDIP and IOOS have played a key role in the decision-making process, by contributing to the safety or economics of marine operations and coastal management. The real-time data are available on the Southern California Coastal Observing System (<ext-link href="http://sccoos.org">http://sccoos.org</ext-link>) and the corresponding Regional Association’s Websites. The data are also transmitted hourly to the National Oceanic and Atmospheric Administration’s National Data Buoy Center and the National Weather Service.

Abstract:

In the archive of the now disbanded jefatura política of Tetela de Ocampo is an account of the funeral ceremony of the Puebla State deputy and school teacher, Ciudadano Miguel Méndez, only son of General Juan Nepomuceno Méndez, caudillo máximo of the State of Puebla between 1857 and 1884. The Velada Fúnebre was held in 1888 in the cabecera of Xochiapulco (alias ‘La Villa del Cinco de Mayo’), a municipio of nahuatl speakers on the southern edge of Mexico's Sierra Madre Oriental, adjoining the cereal producing plateaux of San Juan de los Llanos. The ceremony took place in the ‘Netzahualcoyotl’ municipal school room and was organised by the municipality's Society of Teachers. The description of the elaborately decorated room and baroque ceremony fills several pages.1 The teachers had decked the school room (normally adorned by ‘sixty-two great charts of natural history, twenty Industrial diagrams, large maps of Universal Geography, and diverse statistical charts and many engravings related to education’) with military banners and weapons, masonic trophies, candelabra, floral crowns and yards of white and black ribbon. In the centre of the room stood the coffin on an altar, itself raised upon a platform, guarded by four National Guard sentries and attended by the philharmonic corps of Xochiapulco and all the public officials of the cabecera and its dependent barrios. For nine days preceding the ceremony this band had played funeral marches, between six and eight in the evening, on the plaza, in front of the house of the deceased. The service was taken by Mr Byron Hyde, a Methodist minister from the United States. Accompanied by his wife at a piano, Hyde gave renderings (in English) of three Wesleyan hymns.2 There followed three eulogies of Miguel Méndez, extolling his services to the Liberal cause and on behalf of the ‘desgraciada nación azteca’. These speeches were infused with extreme anticlerical and anti-Conservative sentiments, a martial patriotic liberalism, a reverence for the principles of the French Revolution, an admiration for Garibaldi and Hidalgo (in that order), and an obsession with the importance of education as the only means for emancipating the indigenous population from clerical subjection.

Abstract:

A shared understanding of the benefits and tradeoffs to people from alternative land management strategies is critical to successful decision-making for managing public lands and fostering shared stewardship. This study describes an approach for identifying and monitoring the types of resource benefits and tradeoffs considered in National Forest planning in the United States under the 2012 Planning Rule and demonstrates the use of tools for conceptualizing the production of ecosystem services and benefits from alternative land management strategies. Efforts to apply these tools through workshops and engagement exercises provide opportunities to explore and highlight measures, indicators, and data sources for characterizing benefits and tradeoffs in collaborative environments involving interdisciplinary planning teams. Conceptual modeling tools are applied to a case study examining the social and economic benefits of recreation on the Ashley National Forest. The case study illustrates how these types of tools facilitate dialog for planning teams to discuss alternatives and key ecosystem service outcomes, create easy to interpret visuals that map details in plans, and provide a basis for selecting ecosystem service (socio-economic) metrics. These metrics can be used to enhance environmental impact analysis, and help satisfy the goals of the National Environmental Policy Act (NEPA), the 2012 Planning Rule, and shared stewardship initiatives. The systematic consideration of ecosystem services outcomes and metrics supported by this approach enhanced dialog between members of the Forest planning team, allowed for a more transparent process in identification of key linkages and outcomes, and identified impacts and outcomes that may not have been apparent to the sociologist who is lacking the resource specific expertise of these participants. As a result, the use of the Ecosystem Service Conceptual Model (ESCM) process may result in reduced time for internal reviews and greater comprehension of anticipated outcomes and impacts of proposed management in the plan revision Environmental Impact Statement amongst the planning team.

Abstract:

Abstract The United States Department of Agriculture’s National Agricultural Statistics Service (NASS) conducts the June Agricultural Survey (JAS) annually. Substantial misclassification occurs during the prescreening process and from field-estimating farm status for nonresponse and inaccessible records, resulting in a biased estimate of the number of US farms from the JAS. Here, the Annual Land Utilization Survey (ALUS) is proposed as a follow-on survey to the JAS to adjust the estimates of the number of US farms and other important variables. A three-phase survey design-based estimator is developed for the JAS-ALUS with nonresponse adjustment for the second phase (ALUS). A design-unbiased estimator of the variance is provided in explicit form.

Abstract:

This special issue of the Industrial and Systems Engineering Review highlights top papers from the 2019 annual General Donald R. Keith memorial capstone conference held at the United States Military Academy in West Point, NY. Following careful review of 48 academic paper submissions, eight were selected for publication in this journal. Each paper incorporated features of systems or industrial engineering and presented detailed and reflective analysis in the topic. Three general bodies of knowledge in the papers include: systems engineering and decision analysis, modeling and simulation, and artificial intelligence Systems Engineering and Decision Analysis topics included three unique contributions. The work of Flanick et al. examined adaptability in Hyper-Enabled Operator systems and recommended how each technology might address capability gaps for special operations forces. Wilby et al. employed a scalable predictive statistical model for decision support to significant work package prioritization for U.S. Army Corps of Engineers nationally significant inland waterway infrastructure. Contributions by Shi et al. employed value focused thinking and a robust cost model to enable decision quality for PM Cargo CH-47 technologies. Modeling and Simulation works also included three unique contributions. Recognized as ‘best paper’ at the 2019 conference, work by Cooley et al. developed a senior leader engagement model using sparse K-means clustering techniques to greatly improve the planning and execution for AFRICOM leadership. Lovell et al. employed robust military simulation models to evaluate and propose solutions Soldier Search and Target Acquisition protocols. Work by Drake et al. employed vehicle Routing Problem simulation software to enhance United Health Services material handling challenges across NY State thus enabling quality optimization choices. Finally, two unique contributions in artificial intelligence examined key text mining technologies. Shi et al. employed text mining and Latent Dirichlet Allocation modeling to derive insights through trends and clustering narratives on U.S. Army Officer Evaluation Reports and describe success. Similarly, text mining techniques by Senft et al. helped to examine and show similarities in success narratives across genders thus providing valuable insights for promotion boards. Congratulation to the 2019 undergraduate scholars and all authors who provided valuable contributions through thoughtful and steadfast intellectual efforts to their fields of study! LTC James H. Schreiner, PhD, PMP, CPEM Director, Operations Research Center Department of Systems Engineering United States Military Academy Mahan Hall, Bldg 752, Room 305 West Point, NY 10996, USA james.schreiner@westpoint.edu

Abstract:

In epistemological domains, classification systems play an integral part as tools of discovery and systematic exploration. Classifications are essential for the integrity and validity of any academic research and application of the research findings to that particular research context. Absence of classification systems limits the ability of a discipline to advance as a legitimate subject worthy of academic pursuit. Currently, in the United States, as noted by the National Restaurant Association, there is no standardized and official classification for the restaurant industry. Thus, the current study proposes a theoretically supported restaurant classification system based on the concept of hedonic and utilitarian consumption. The proposed classification system has been empirically tested in four different studies, including a panel of currently operating restaurateurs, food journalists specializing in restaurant industry, panel of hospitality educators, and restaurant customers. The proposed framework has received strong empirical support from all four selected groups. The obtained results suggest that this parsimonious system could be effectively used to classify the U.S. restaurant industry with the proposed four major classes: Luxury Restaurants, Fine-Dining Restaurants, Casual Restaurants, and Quick-Service Restaurants.

Abstract:

Abstract Extended precipitation forecasts, with leads of weeks to seasons, are valuable for planning water use and are produced by the U.S. National Weather Service. Forecast skill tends to be low and any skill improvement could be valuable. Here, methods are discussed for improving statistical precipitation forecasting over the contiguous United States. Monthly precipitation is forecast using predictors from the previous month. Testing shows that improvements are obtained from both improved statistical methods and from the use of satellite-based ocean-area precipitation predictors. The statistical superensemble method gives higher skill compared to traditional statistical forecasting. Ensemble statistical forecasting combines individual forecasts. The proposed superensemble is a weighted mean of many forecasts or of forecasts from different prediction systems and uses the forecast reliability estimate to define weights. The method is tested with different predictors to show its skill and how skill can be improved using additional predictors. Cross validation is used to evaluate the skill. Although predictions are strongly influenced by ENSO, in the superensemble other regions contribute more to the forecast skill. The superensemble optimally combines forecasts based on different predictor regions and predictor types. The contribution from multiple predictor regions improves skill and reduces the ENSO spring barrier. Adding satellite-based ocean-area precipitation predictors noticeably increases forecast skill. The resulting skill is comparable to that from dynamic-model forecasts, but the regions with best forecast skill may be different. This paper shows that the statistical superensemble forecasts may be complementary to dynamic forecasts and that combining them may further increase forecast skill.

Abstract:

There is an increasing demand for sharing documents for process integration among organizations. Web services technology has recently been widely proposed and gradually adopted as a platform for supporting such an integration. There are no holistic solutions thus far that are able to tackle the various protection issues, specifically regarding the security and privacy protection requirements in cross-organizational progress integration. This paper proposes the exchange of documents through a Document / Image Exchange Platform (DIEP), replacing traditional ad-hoc and manual exchange practices. The authors show how the contemporary technologies of Web services under a Service-Oriented Architecture (SOA), together with watermarking, can help protect document exchanges with layered implementation architecture. Furthermore, to facilitate governance and regulation compliance against protection policy violation attempts, the management and the affected parties are notified with alerts for warning and possible handling. The authors discuss the applicability of the proposed platform with a physician towards security and privacy protection requirements based on the Health Insurance Portability and Accountability Act (HIPAA) in the United States, which imposes national regulations to protect individuals’ healthcare information. The proposed approach aims at facilitating the whole governance process from technical to management level with a single unified platform.

Abstract:

<p>Accountable Care Organizations (ACO) in the United States of America (USA) and Clinical Commissioning Groups (CCG) in the United Kingdom (UK) are new proposed organizations in health services both tasked with a role which includes improving public health. Although there are very significant differences between the UK and USA health systems there appears to be a similar confusion as to how ACO and CCG will regard and address public or population health. The role of ACO in improving population health and evaluating the health needs of their registered and insured patients remains ill-defined and poorly explored. Likewise, in the current UK National Health Service (NHS) reorganisation, control and commissioning of appropriate local health services are passing from Primary Care Trusts (PCT) to new cross-organizational structures (CCG). CCG groups aim to be, like ACO, physician led. They will also assume a role for public or population health, but this role, like that of the newly-forming ACO, is currently unclear. Lessons learned from the USA and UK experience of new organizations tasked with a role in improving public health may inform mechanisms for physician led organizations in the UK and the USA to assess health needs, monitor population health information and improve population health outcomes.</p>

Abstract:

FHWA’s Long-Term Pavement Performance (LTPP) information management system (IMS) is a relational database management system that has been developed to collect the data necessary to accomplish the goals of the LTPP program established under the Strategic Highway Research Program. The LTPP database and the technology available to collect and manage the data have evolved a great deal since the initial design of the system in 1988. Data from this system are available to users by request by filling out a form. Although some upgrades have been made to hardware and software, a comprehensive evaluation of the computing environment and general IMS procedures had not been performed until the migration analysis. The original design of the LTPP IMS is based on four stand-alone IBM-compatible single-user personal computers transferring data to a minicomputer at the national center that houses all the data collected throughout the United States and Canada. The design concept and some details for the establishment of a national distributed network for the internal operation of the LTPP IMS, intended to migrate to a system that is more compatible with the current hardware and software technology, are described. On the basis of the evaluation of the options considered, cost, technical criteria, and management considerations, the design platform for migration is established as upgrades to Oracle V7, Windows NT, and a national distributed client-server environment. An Integrated Services Digital Network solution is recommended for the network communication. The proposed environment will greatly enhance the data processing and administrative capabilities of the FHWA LTPP IMS. As a result, the data availability and customer service to end users of the data such as state highway agencies would improve.

Abstract:

The Saudi Arabian healthcare system is currently undergoing a process of reform. While it previously adopted a universal access approach in which all health care was provided free-of-charge to citizens at the point of care, this has been identified as unsustainable into the future. The shift towards an ageing population and the increasing burden of chronic disease, along with increasing use of technology and development of expensive treatments, mean that health care costs in Saudi Arabia are likely to increase significantly in the near future. Therefore, new ways to fund healthcare have been explored, with the solution proposed being a social insurance model in which employment contributions pay for care. This study seeks to identify the different alternatives which are available to the Saudi government and investigate the outcomes of these alternatives in their respective countries of use. The study examined the private insurance system in the United States of America, the social insurance system in Australia, the United Kingdom’s National Health Service, and the Public Private Partnership adopted by Singapore. It would seem that the Singaporean model is associated with the lowest level of government spending to maintain a high quality of patient care. However, further in-depth analysis is required to better understand how this model would apply to the Saudi Arabian context.

Abstract:

AbstractUp-to-date information about an emergency is crucial for effective disaster management. However, severe restrictions impede the creation of spatiotemporal information by current remote sensing-based monitoring systems, especially at the beginning of a disaster. Multiple publications have shown promising results in complementing monitoring systems through spatiotemporal information extracted from social media data. However, various monitoring system criteria, such as near-real-time capabilities or applicability for different disaster types and use cases, have not yet been addressed. This paper presents an improved version of a recently proposed methodology to identify disaster-impacted areas (hot spots and cold spots) by combining semantic and geospatial machine learning methods. The process of identifying impacted areas is automated using semi-supervised topic models for various kinds of natural disasters. We validated the portability of our approach through experiments with multiple natural disasters and disaster types with differing characteristics, whereby one use case served to prove the near-real-time capability of our approach. We demonstrated the validity of the produced information by comparing the results with official authority datasets provided by the United States Geological Survey and the National Hurricane Centre. The validation shows that our approach produces reliable results that match the official authority datasets. Furthermore, the analysis result values are shown and compared to the outputs of the remote sensing-based Copernicus Emergency Management Service. The information derived from different sources can thus be considered to reliably detect disaster-impacted areas that were not detected by the Copernicus Emergency Management Service, particularly in densely populated cities.

Abstract:

Clustering emerged as powerful mechanism to analyze the massive data generated by modern applications; the main aim of it is to categorize the data into clusters where objects are grouped into the particular category. However, there are various challenges while clustering the big data recently. Deep Learning has been powerful paradigm for big data analysis, this requires huge number of samples for training the model, which is time consuming and expensive. This can be avoided though fuzzy approach. In this research work, we design and develop an Improvised Fuzzy C-Means (IFCM)which comprises the encoder decoder Convolutional Neural Network (CNN) model and Fuzzy C-means (FCM) technique to enhance the clustering mechanism. Encoder decoder based CNN is used for learning feature and faster computation. In general, FCM, we introduce a function which measure the distance between the cluster center and instance which helps in achieving the better clustering and later we introduce Optimized Encoder Decoder (OED) CNN model for improvising the performance and for faster computation. Further in order to evaluate the proposed mechanism, three distinctive data types namely Modified National Institute of Standards and Technology (MNIST), fashion MNIST and United States Postal Service (USPS) are used, also evaluation is carried out by considering the performance metric like Accuracy, Adjusted Rand Index (ARI) and Normalized Mutual Information (NMI). Moreover, comparative analysis is carried out on each dataset and comparative analysis shows that IFCM outperforms the existing model.

Abstract:

Hurricane Sandy hit the East Coast of the United States on October 29th, 2012, caused over $63 billion in damage, destroyed thousands of homes, left over 8 million people without electrical service, and killed at least 131 people in eight states. Amongst the damage was the unique case of the grounded Tank Vessel, JOHN B. CADDELL on New York's Staten Island. The CADDELL posed a distinctive challenge to pollution mitigation and eventual vessel removal efforts, being stateless/ownerless, and commanded high profile media/public attention. Responders used a variety of creative methods to ensure the surrounding environment was not further affected by the grounded vessel, including the authorized use of solidifying agents. This poster describes the procedures used to determine vessel disposition and explores the innovative use of solidifiers in this particular case. Determining final disposition of the vessel involved an extensive process of multi-agency cooperation and coordination. Leveraging the existing authorities of the New York's Sheriff's Department to dispose of abandoned vessels, the Coast Guard was able to work with local, state and federal partners to implement a removal plan. Additionally, National Strike Force and Coast Guard Sector New York personnel utilized the cutting edge technology of solidifying polymer agents to effectively reduce the amount of contaminants onboard the vessel. As per the Area Contingency Plan, the Regional Response Team-Region 2 (RRT-2) was activated, and was used to brief Federal and State member agencies on the planned protective use of a solidifier by the Federal On-Scene Coordinator during cleanup efforts. RRT-2 was provided a current situational brief, objectives, and a proposed application plan. RRT-2 concurred with the utilization plan, and contributed some additional recommendations, which enhanced cleanup operations conducted under the ESF-10 Mission Assignment from New York State.

Abstract:

Ponderosa pine forests in the southwestern United States of America are overly dense, increasing the risk of high-intensity stand-replacing wildfires that result in the loss of terrestrial carbon and release of carbon dioxide, contributing to global climate change. Restoration is needed to restore forest structure and function so that a more natural regime of higher frequency, lower intensity wildfires returns. However, restoration has been hampered by the significant cost of restoration and other institutional barriers. To create additional revenue streams to pay for restoration, the National Forest Foundation supported the development of a methodology for the estimation and verification of carbon offsets generated by the restoration of ponderosa pine forests in northern Arizona. The methodology was submitted to the American Carbon Registry, a prominent carbon registry, but it was ultimately rejected. This paper presents a post-mortem examination of that methodology and the reasons it was rejected in order to improve the development of similar methodologies in the future. Using a mixed-methods approach, this paper analyzes the potential atmospheric carbon benefits of the proposed carbon offset methodology and the public and peer-reviewed comments from the associated review of the methodology. Results suggest a misalignment between the priorities of carbon registries and the context-specific ecosystem service benefits of this type of restoration; although findings confirm the potential for reductions in released carbon due to restoration, these results illuminate barriers that complicate registering these reductions as voluntary carbon offsets under current guidelines and best practices, especially on public land. These barriers include substantial uncertainty about the magnitude and timing of carbon benefits. Overcoming these barriers will require active reflexivity by the institutions that register voluntary carbon offsets and the institutions that manage public lands in the United States. Such reflexivity, or reconsideration of the concepts and purposes of carbon offsets and/or forest restoration, will allow future approaches to better align objectives for successfully registering restoration-based voluntary carbon offsets. Therefore, the results of this analysis can inform the development of future methodologies, policies, and projects with similar goals in the same or different landscapes.

Abstract:

An accurate prediction of the future condition of structural components is essential for planning the maintenance, repair, and rehabilitation of bridges. As such, this paper presents an application of Artificial Neural Networks (ANN) to predict future deck condition for highway bridges in the State of Alabama, the United States. A library of 2572 bridges was extracted from the National Bridge Inventory (NBI) database and used for training, validation, and testing the ANN model, which had eight input parameters and one output being the deck rating. Specifically, the eight input parameters are Current Bridge Age, Average Daily Traffic, Design Load, Main Structure Design, Approach Span Design, Number of main Span, Percent of Daily Truck Traffic, and Average Daily Traffic Growth Rate. The results indicated the obtained ANN model can predict the condition rating of the bridge deck with an accuracy of 73.6%. If a margin error of ±1 was used, the accuracy of the proposed model reached a much higher value of 98.5%. Besides, a sensitivity analysis was conducted for individual input parameters revealed that Current Bridge Age was the most important predicting parameter of bridge deck rating. It was followed by the Design Load and Main Structure Design. The other input parameters were found to have neglectable effects on the ANN’s performance. Finally, it was shown that the obtained ANN can be used to develop the deterioration curve of the bridge deck, which helps visualize the condition rating of a deck, and accordingly the maintenance need, during its remaining service life. Keywords: condition rating; bridge deck; deterioration curve; artificial neural networks; sensitivity analysis.

Abstract:

Yellow veinbanding symptoms have been observed in several mint clones at the U.S. Department of Agriculture, Agricultural Research Service, National Clonal Germplasm Repository (NCGR) mint collection in Corvallis, Oregon. The most dramatic symptoms are in a “variegated” clone of Mentha × gracilis Sole (NCGR Accession No. MEN-454), which is marketed widely in the nursery industry under cultivar names such as Golden Ginger Mint and Green and Gold. Tucker and Fairbrothers (2) proposed the name Mentha gentilis (= M. × gracilis) L. ‘Variegata’ for forms of this species with a graft transmissible variegation. Doublestranded RNA (dsRNA) was extracted from three mint clones with veinbanding symptoms of varying intensity. The dsRNA from MEN-454 was cloned, and sequences from several clones corresponded to RNA 2 of Strawberry latent ringspot virus (SLRSV), a tentative member of the family Sequiviridae. Sequences of additional cDNA clones suggested that two previously unknown viruses and the satellite RNA of SLRSV were also present in MEN-454. On the basis of the sequences of the SLRSV clones, primers F (5′ CCTCTCCAACCTGCTAGACT 3′) and R (5′ AAGCGCATGAAGGTGTAACT 3′) were developed and used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify a 497-bp fragment of RNA 2 of SLRSV from MEN-454. No amplicons in RT-PCR tests or dsRNA was obtained from a clone of MEN-454 that was freed of the yellow vein symptom by heat therapy and apical meristem culture. The consensus sequence of cloned dsRNA and sequenced PCR products for SLRSV from MEN-454 has been deposited in GenBank (Accession No. AY 438666). Chenopodium quinoa, inoculated mechanically with leaf extracts from MEN-454, developed chlorosis and apical necrosis that were similar to symptoms reported for SLRSV infection (1). The presence of SLRSV in C. quinoa was confirmed using RT-PCR. Variegated M. × gracilis clones were obtained from wholesale and mail-order nurseries in Maryland, Ohio, and Nebraska. Samples were assayed using RT-PCR utilizing the F and R primers for presence of SLRSV. All samples tested positive for the virus using RT-PCR. Because of the presence of additional viruses, we cannot attribute yellow vein symptoms solely to SLRSV, however the presence of this virus in clones of M. × gracilis ‘Variegata’ from different regions throughout the United States demonstrates that SLRSV is distributed widely in the United States. To our knowledge, this is the first report of SLRSV in mint in North America. References: (1) K. Schmelzer. Phytopathol. Z. 66:1, 1969. (2) A. O. Tucker and D. E. Fairbrothers. Taxon 21:209, 1972.

Abstract:

From its beginning, mankind suffered injuries through falling, fire, drowning and human aggression [1]. Although the frequency and the kinetics modifiy over millennia, trauma continues to represent an important cause of morbidity and mortality even in the modern society [1]. Significant progresses in the trauma surgery were due to military conflicts, which next to social sufferance came with important steps in injuries’ management, further applied in civilian hospitals. The foundation of modern trauma systems was started by Dominique Jean Larrey (1766-1842) during the Napoleonic Rin military campaign from 1792. The wounded who remained on the battlefield till the end of the battle to receive medical care, usually more than 24 hours, from that moment were transported during the conflict with flying ambulances to mobile hospitals. Starting with the First World War, through the usage of antiseptics, blood transfusions, and fracture management, the mortality decreased from 39% in the Crimean War (1853–1856) to 10%. One of the most preeminent figures of the Second World War was Michael DeBakey, who created the Mobile Army Surgical Hospitals (MASH), concept very similar to the Larrey’s unit. In 1941, in England, Birmingham Accident Hospital was opened, specially designed for injured people, this being the first trauma center worldwide. During the Golf War (1990–1991) the MASH were used for the last time, being replaced by Forward Surgical Teams, very mobile units satisfying the necessities of the nowadays infantry [1]. Nowadays, trauma meets the pandemic criteria, everyday 16,000 people worldwide are dying, injuries representing one of the first five causes of mortality for all the age groups below 60 [2]. A recent 12-month analysis of trauma pattern in the Emergency Hospital of Bucharest revealed 141 patients, 72.3% males, with a mean age of 43.52 ± 19 years, and a mean New Injury Severity Score (NISS) of 27.58 ± 11.32 [3]. The etiology was traffic related in 101 (71.6%), falls in 28 (19.9%) and crushing in 7 (5%) cases. The overall mortality was as high as 30%, for patients with a mean NISS of 37.63 [3]. At the scene, early recognition of severe injuries and a high index of suspicion according to trauma kinetics may allow a correct triage of patients [4]. A functional trauma system should continuously evaluate the rate of over- and under-triage [5]. The over-triage represents the transfer to a very severe patient to a center without necessary resources, while under-triage means a low injured patient referred to a highly specialized center. If under-triage generates preventable deaths, the over-triage comes with a high financial and personal burden for the already overloaded tertiary centers [5]. To maximize the chance for survival, the major trauma patients should be transported as rapid as possible to a trauma center [6]. The initial resuscitation of trauma patients was divided into two time intervals: ten platinum minutes and golden hour [6]. During the ten platinum minutes the airways should be managed, the exsanguinating bleeding should be stopped, and the critical patients should be transported from the scene. During the golden hour all the life-threatening lesions should be addressed, but unfortunately many patients spend this time in the prehospital setting [6]. These time intervals came from Trunkey’s concept of trimodal distribution of mortality secondary to trauma, proposed in 1983 [7]. This trimodal distribution of mortality remains a milestone in the trauma education and research, and is still actual for development but inconsistent for efficient trauma systems [8]. The concept of patients’ management in the prehospital setting covered a continuous interval, with two extremities: stay and play/treat then transfer or scoop and run/ load and go. Stay and play, usually used in Europe, implies airways securing and endotracheal intubation, pleurostomy tube insertion, and intravenous lines with volemic replacement therapy. During scoop and run, used in the Unites States, the patient is immediately transported to a trauma center, addressing the immediate life-threating injuries during transportation. In the emergency department of the corresponding trauma center, the resuscitation of the injured patients should be done by a trauma team, after an orchestrated protocol based on Advanced Trauma Life Support (ATLS). The modern trauma teams include five to ten specialists: general surgeons trained in trauma care, emergency medicine physicians, intensive care physicians, orthopedic surgeons, neurosurgeons, radiologists, interventional radiologists, and nurses. In the specially designed trauma centers, the leader of the trauma team should be the general surgeon, while in the lower level centers this role may be taken over by the emergency physicians. The implementation of a trauma system is a very difficult task, and should be tailored to the needs of the local population. For example, in Europe the majority of injuries are by blunt trauma, while in the United States or South Africa they are secondary to penetrating injuries. In an effort to analyse at a national level the performance of trauma care, we have proposed a national registry of major trauma patients [9]. For this registry we have defined major trauma as a New Injury Severity Score higher than 15. The maintenance of such registry requires significant human and financial resources, while only a permanent audit may decrease the rate of preventable deaths in the Romanian trauma care (Figure 1) [10]. Figure 1 - The website of Romanian Major Trauma Registry (http://www.registrutraume.ro). USA - In the United States of America there are 203 level I centers, 265 level II centers, 205 level III or II centers and only 32 level I or II pediatric centers, according to the 2014 report of National Trauma Databank [11]. USA were the first which recognized trauma as a public health problem, and proceeded to a national strategy for injury prevention, emergency medical care and trauma research. In 1966, the US National Academy of Sciences and the National Research Council noted that ‘’public apathy to the mounting toll from accidents must be transformed into an action program under strong leadership’’ [12]. Considerable national efforts were made in 1970s, when standards of trauma care were released and in 1990s when ‘’The model trauma care system plan’’[13] was generated. The American College of Surgeons introduced the concept of a national trauma registry in 1989. The National Trauma Databank became functional seven years later, in 2006 being registered over 1 million patients from 600 trauma centers [14]. Mortality from unintentional injury in the United States decreased from 55 to 37.7 per 100,000 population, in 1965 and 2004, respectively [15]. Due to this national efforts, 84.1% of all Americans have access within one hour from injury to a dedicated trauma care [16]. Canada - A survey from 2010 revealed that 32 trauma centers across Canada, 16 Level I and 16 Level II, provide definitive trauma care [18]. All these centers have provincial designation, and funding to serve as definitive or referral hospital. Only 18 (56%) centers were accredited by an external agency, such as the Trauma Association of Canada. The three busiest centers in Canada had between 798–1103 admissions with an Injury Severity Score over 12 in 2008 [18]. Australia - Australia is an island continent, the fifth largest country in the world, with over 23 million people distributed on this large area, a little less than the United States. With the majority of these citizens concentrated in large urban areas, access to the medical care for the minority of inhabitants distributed through the territory is quite difficult. The widespread citizens cannot be reached by helicopter, restricted to near-urban regions, but with the fixed wing aircraft of the Royal Flying Doctor Service, within two hours [13]. In urban centers, the trauma care is similar to the most developed countries, while for people sparse on large territories the trauma care is far from being managed in the ‘’golden hour’’, often extending to the ‘’Golden day’’ [19]. Germany - One of the most efficient European trauma system is in Germany. Created in 1975 on the basis of the Austrian trauma care, this system allowed an over 50% decreasing of mortality, despite the increased number of injuries. According to the 2014 annual report of the Trauma Register of German Trauma Society (DGU), there are 614 hospitals submitting data, with 34.878 patients registered in 2013 [20]. The total number of cases documented in the Trauma Register DGU is now 159.449, of which 93% were collected since 2002. In the 2014 report, from 26.444 patients with a mean age of 49.5% and a mean ISS of 16.9, the observed mortality was 10% [20]. The United Kingdom - In 1988, a report of the Royal College of Surgeons of England, analyzing major injuries concluded that one third of deaths were preventable [21]. In 2000, a joint report from the Royal College of Surgeons of England and of the British Orthopedic Association was very suggestive entitled "Better Care for the Severely Injured" [22]. Nowadays the Trauma Audit Research network (TARN) is an independent monitor of trauma care in England and Wales [23]. TARN collects data from hospitals for all major trauma patients, defined as those with a hospital stay longer than 72 hours, those who require intensive care, or in-hospital death. A recent analysis of TARN data, looking at the cost of major trauma patients revealed that the total cost of initial hospital inpatient care was £19.770 per patient, of which 62% was attributable to ventilation, intensive care and wards stays, 16% to surgery, and 12% to blood transfusions [24]. Global health care models Countries where is applied Functioning concept Total healthcare costs from GDP Bismarck model Germany Privatized insurance companies (approx. 180 nonprofit sickness funds). Half of the national trauma beds are publicly funded trauma centers; the remaining are non-profit and for-profit private centers. 11.1% Beveridge model United Kingdom Insurance companies are non-existent. All hospitals are nationalized. 9.3% National health insurance Canada, Australia, Taiwan Fusion of Bismarck and Beveridge models. Hospitals are privatized, but the insurance program is single and government-run. 11.2% for Canada The out-of-pocket model India, Pakistan, Cambodia The poorest countries, with undeveloped health care payment systems. Patients are paying for more than 75% of medical costs. 3.9% for India GDP – gross domestic product Table 1 - Global health care models with major consequences on trauma care [17]. Traumas continue to be a major healthcare problem, and no less important than cancer and cardiovascular diseases, and access to dedicated and timely intervention maximizes the patients’ chance for survival and minimizes the long-term morbidities. We should remember that one size does not fit in all trauma care. The Romanian National Trauma Program should tailor its resources to the matched demands of the specific Romanian urban and rural areas.

Abstract:

ContentsGreen Chemistry in the International ContextThe Concept of green ChemistryDefinition of green chemistry | Green chemistry: Why now? | The historical context of green chemistry | The emergence of green chemistryThe Content of Green ChemistryAreas of green chemistry | Preliminary remarks | Alternative feedstocks | Benign reagents/synthetic pathways | Synthetic transformations | Solvents/reaction conditionsGreen Chemistry in the International ContextIt has come to be recognized in recent years, that the science of chemistry is central to addressing the problems facing the environment. Through the utilization of the various subdisciplines of chemistry and the molecular sciences, there is an increasing appreciation that the emerging area of green chemistry1is needed in the design and attainment of sustainable development. A central driving force in this increasing awareness is that green chemistry accomplishes both economic and environmental goals simultaneously through the use of sound, fundamental scientific principles. Recently, a basic strategy has been proposed for implementing the relationships between industry and academia, and hence, funding of the research that constitutes the engine of economic advancement; it is what many schools of economics call the "triple bottom line" philosophy, meaning that an enterprise will be economically sustainable if the objectives of environmental protection, societal benefit, and market advantage are all satisfied2. Triple bottom line is a strong idea for evaluating the success of environmental technologies. It is clear that the best environmentally friendly technology or discovery will not impact on the market if it is not economically advantageous; in the same way, the market that ignores environmental needs and human involvement will not prosper. This is the challenge for the future of the chemical industry, its development being strongly linked to the extent to which environmental and human needs can be reconciled with new ideas in fundamental research. On the other hand, it should be easy to foresee that the success of environmentally friendly reactions, products, and processes will improve competitiveness within the chemical industry. If companies are able to meet the needs of society, people will influence their own governments to foster those industries attempting such environmental initiatives. Of course, fundamental research will play a central role in achieving these worthy objectives. What we call green chemistry may in fact embody some of the most advanced perspectives and opportunities in chemical sciences.It is for these reasons that the International Union of Pure and Applied Chemistry (IUPAC) has a central role to play in advancing and promoting the continuing emergence and impact of green chemistry. When we think about how IUPAC furthers chemistry throughout the world, it is useful to refer to IUPAC's Strategic Plan. This plan demonstrates the direct relevance of the mission of IUPAC to green chemistry, and explains why there is growing enthusiasm for the pursuit of this new area as an appropriate activity of a scientific Union. The IUPAC Strategic Plan outlines among other goals:IUPAC will serve as a scientific, international, nongovernmental body in objectively addressing global issues involving the chemical sciences. Where appropriate, IUPAC will represent the interests of chemistry in governmental and nongovernmental forums.IUPAC will provide tools (e.g., standardized nomenclature and methods) and forums to help advance international research in the chemical sciences.IUPAC will assist chemistry-related industry in its contributions to sustainable development, wealth creation, and improvement in the quality of life.IUPAC will facilitate the development of effective channels of communication in the international chemistry community.IUPAC will promote the service of chemistry to society in both developed and developing countries.IUPAC will utilize its global perspective to contribute toward the enhancement of education in chemistry and to advance the public understanding of chemistry and the scientific method.IUPAC will make special efforts to encourage the career development of young chemists.IUPAC will broaden the geographical base of the Union and ensure that its human capital is drawn from all segments of the world chemistry community.IUPAC will encourage worldwide dissemination of information about the activities of the Union.IUPAC will assure sound management of its resources to provide maximum value for the funds invested in the Union.Through the vehicle of green chemistry, IUPAC can engage and is engaging the international community in issues of global importance to the environment and to industry, through education of young and established scientists, the provision of technical tools, governmental engagement, communication to the public and scientific communities, and the pursuit of sustainable development. By virtue of its status as a leading and internationally representative scientific body, IUPAC is able to collaborate closely in furthering individual national efforts as well as those of multinational entities.An important example of such collaboration in the area of green chemistry is that of IUPAC with the Organization for the Economical Cooperation and Development (OECD) in the project on "Sustainable Chemistry", aimed at promoting increased awareness of the subject in the member countries. During a meeting of the Environment Directorate (Paris, 6 June 1999), it was proposed that United States and Italy co-lead the activity, and that implementation of five recommendations to the member countries be accorded the highest priority, namely:research and developmentawards and recognition for work on sustainable chemistryexchange of technical information related to sustainable chemistryguidance on activities and tools to support sustainable chemistry programssustainable chemistry educationThese recommendations were perceived to have socio-economic implications for worldwide implementation of sustainable chemistry. How IUPAC and, in particular, its Divisions can contribute to this effort is under discussion. IUPAC is recognized for its ability to act as the scientific counterpart to OECD for all recommendations and activities. Although the initiatives being developed by the OECD are aimed primarily at determining the role that national institutions can play in facilitating the implementation and impact of green chemistry, it is recognized that each of these initiatives also has an important scientific component. Whether it is developing criteria or providing technical assessment for awards and recognition, identifying appropriate scientific areas for educational incorporation, or providing scientific insight into the areas of need for fundamental research and development, IUPAC can play and is beginning to play an important role as an international scientific authority on green chemistry.Other multinational organizations including, among others, the United Nations, the European Union, and the Asian Pacific Economic Community, are now beginning to assess the role that they can play in promoting the implementation of green chemistry to meet environmental and economic goals simultaneously. As an alternative to the traditional regulatory framework often implemented as a unilateral strategy, multinational governmental organizations are discovering that green chemistry as a nonregulatory, science-based approach, provides opportunities for innovation and economic development that are compatible with sustainable development. In addition, individual nations have been extremely active in green chemistry and provide plentiful examples of the successful utilization of green chemistry technologies. There are rapidly growing activities in government, industry, and academia in the United States, Italy, the United Kingdom, the Netherlands, Spain, Germany, Japan, China, and many other countries in Europe and Asia, that testify to the importance of green chemistry to the future of the central science of chemistry around the world.Organizations and Commissions currently involved in programs in green chemistry at the national or international level include, for example:U.S. Environmental Protection Agency (EPA), with the "Green Chemistry Program" which involves, among others, the National Science Foundation, the American Chemical Society, and the Green Chemistry Institute;European Directorate for R&D (DG Research), which included the goals of sustainable chemistry in the actions and research of the European Fifth Framework Programme;Interuniversity Consortium "Chemistry for the Environment", which groups about 30 Italian universities interested in environmentally benign chemistry and funds their research groups;UK Royal Society of Chemistry, which promotes the concept of green chemistry through a "UK Green Chemistry Network" and the scientific journal Green Chemistry;UNIDO-ICS (International Centre for Science and High Technology of the United Nations Industrial Development Organization) which is developing a global program on sustainable chemistry focusing on catalysis and cleaner technologies with particular attention to developing and emerging countries (the program is also connected with UNIDO network of centers for cleaner production); andMonash University, which is the first organization in Australia to undertake a green chemistry program.Footnotes:1. The terminology "green chemistry" or "sustainable chemistry" is the subject of debate. The expressions are intended to convey the same or very similar meanings, but each has its supporters and detractors, since "green" is vividly evocative but may assume an unintended political connotation, whereas "sustainable" can be paraphrased as "chemistry for a sustainable environment", and may be perceived as a less focused and less incisive description of the discipline. Other terms have been proposed, such as "chemistry for the environment" but this juxtaposition of keywords already embraces many diversified fields involving the environment, and does not capture the economic and social implications of sustainability. The Working Party decided to adopt the term green chemistry for the purpose of this overview. This decision does not imply official IUPAC endorsem*nt for the choice. In fact, the IUPAC Committee on Chemistry and Industry (COCI) favors, and will continue to use sustainable chemistry to describe the discipline.2. J. Elkington, &lt; http://www.sustainability.co.uk/sustainability.htm

Abstract:

Established in 1889, the United States Public Health Service Commissioned Corps (Corps) is one of the seven uniformed services and is part of the U.S. Department of Health and Human Services. The Corps is committed to protecting, promoting and advancing the health and safety of the nation with a history that dates back over two centuries, beginning as the U.S. Marine Hospital Service. Today, the Corps responds and serves in many areas impacted by natural disasters, disease outbreaks, terrorist attacks and public health emergencies. Corps officers have deployed to provide assistance during national public health emergencies (e.g., hurricanes, bombings, flooding and wild fires); to combat the Ebola epidemic in West Africa; and to provide humanitarian assistance in Latin America and the Caribbean. Corps deployments impact not only service members but also their families. This article offers a brief overview of the Corps and discusses how deployments impact families. Family resiliency and future implications for research and practice will also be examined.

Abstract:

Gray & Pape, Inc., of Houston, Texas, conducted an intensive pedestrian cultural resources survey of jurisdictional portions of survey corridor within a proposed pipeline alignment measuring a total of approximately 30 kilometers (18.5 miles) located in Harris and Liberty Counties, Texas. The pipeline route is on privately-owned property; therefore, a Texas Antiquities Permit was not required prior to survey. In total, the surveyed property totals approximately 2.8 hectares (7 acres) which defines the Area of Potential Effects. The goals of the survey were to establish whether or not previously unidentified archaeological resources were located within the project area, also defined as the project’s Area of Potential Effects, and whether the pipeline alignment would affect any previously identified cultural resources. The lead agency for the project has been identified as the United States Army Corps of Engineers, Galveston District. The procedures to be followed by the United States Army Corps of Engineers to fulfill the requirements set forth in the National Historic Preservation Act, other applicable historic preservation laws, and Presidential directives as they relate to the regulatory program of the United States Army Corps of Engineers (33 CFR Parts 320-334) are articulated in the Regulatory Program of the United States Army Corps of Engineers, Part 325 -Processing of Department of the Army Permits, Appendix C -Procedures for the Protection of Historic Properties. All fieldwork and reporting activities were completed following accepted standards set forth by the Texas Historical Commission and the Council of Texas Archeologists and in accordance with Section 106 of the National Historic Preservation Act. Fieldwork took place in March 2019 and required 32 work hours to complete. Field investigation consisted of intensive pedestrian inspection, subsurface shovel testing, photographic documentation, and mapping. A total of 20 shovel tests were excavated, of which none were positive for buried cultural materials. No historic structures were identified as a result of survey. Based on the results of the survey, Gray & Pape, Inc. recommends that no further cultural resources work be required and that the project be cleared to proceed as currently planned.

Abstract:

Gray & Pape, Inc., of Houston, Texas, on behalf of Lone Star NGL Pipeline, LP, conducted an intensive pedestrian cultural resources survey within permitted areas of the 174.36-kilometer (108.34-mile) long Lone Star Express II Pipeline Project – Loop 1, in Midland, Martin, Howard, Mitchell, and Nolan Counties, Texas. The lead agency for the project has been identified as the United States Army Corps of Engineers, Fort Worth District (Permit No. SWG-2019-00091). Thus, survey efforts concentrated on areas anticipated to be under the jurisdiction of the United States Army Corps of Engineers (permit areas). Within Loop 1, the total Area of Potential Effects within the permit areas measures approximately 125.6 hectares (310.3 acres). This area encapsulates approximately 29.6 kilometers (18.4 miles) of proposed project alignment. In addition, approximately 2.3 kilometers (1.4 miles) or 8.9 hectares (21.9 acres) of the proposed route are controlled by the City of Colorado City and thus required the issuance of a Texas Antiquities Code Permit. Permit number 8896 was issued for the project. The procedures to be followed by the United States Army Corps of Engineers to fulfill the requirements set forth in the National Historic Preservation Act, other applicable historic preservation laws, and Presidential directives as they relate to the regulatory program of the United States Army Corps of Engineers (33 CFR Parts 320-334) are articulated in the Regulatory Program of the United States Army Corps of Engineers, Part 325 - Processing of Department of the Army Permits, Appendix C - Procedures for the Protection of Historic Properties. All fieldwork and reporting activities were completed according to a scope of work submitted to the United States Army Corps of Engineers and the Texas Historical Commission and accepted standards set forth by the Texas Historical Commission and the Council of Texas Archeologists and in accordance with Section 106 of the National Historic Preservation Act. Gray & Pape, Inc. submitted project records to the Center of Archaeological Studies at Texas State University. A records and literature review of the project location prior to survey identified 62 previously recorded archaeological resources, one cemetery, one historic marker, and 22 previously conducted surveys within a 0.8-kilometer (0.5-mile) radius of the Loop 1 segment. Of those, 10 recorded archaeological resources and six previous surveys intersect anticipated permit areas. Fieldwork on Loop 1 was conducted in the Spring of 2019 with supplemental survey in July, August, and September 2019. Survey of Loop 1 required approximately 1,200 Gray & Pape, Inc. person-hours to complete and involved archaeological reconnaissance and shovel testing throughout anticipated permit areas within the project corridor. In total, approximately 664 shovel tests were excavated within permit areas, 25 of which were positive for cultural materials. An additional 122 shovel tests were conducted as part of resource delineation efforts. Field effort also included the excavation of a total of 13 deep tests. Nine previously recorded resources: 41NL6, 41NL313, 41NL314, 41NL315, 41NL316, 41NL320, 41NL321, 41NL323, and 41NL326; eight new previously unrecorded resources: 41HW142, 41MH128, 41MH130, 41NL377, 41NL378, 41NL379, 41NL380, and 41NL392; and four isolate finds were identified within Loop 1 permit areas. An additional 10 previously recorded resources: 41MD41, 41HW8, 41HW104, 41HW105, 41HW106, 41NL310, 41NL312, 41NL322, 41NL324, and 41NL325; and one newly identified resource, 41MH129, were identified within the Area of Potential Effects but outside of jurisdictional areas. These sites largely exhibited surface scatters of lithics which are typical for the area and were consistent with the resources identified within jurisdictional permit areas.

Abstract:

The article reveals the constitutional and legal foundations and features of the formation of the corps of professional judges in foreign countries. It has been established that in many countries there is an independent specialized body, whose competence is to ensure the training of candidates applying for positions of judges, for example, in France – the National School of Magistracy, Georgia – the High Council of Justice, Poland – the National Council of Judicial Procedure, Germany – a selection committee, Croatia – Council of State, United States of America – Senate Judicial Committee, Great Britain – Commission on the Appointment of Judges. It has been established that the process of training candidates applying for judicial positions should take into account the aspect of skills development provided for in the Convention for the Protection of Human Rights and Fundamental Freedoms. It has been proven that in the context of the implementation of special training for candidates applying for judicial positions, one should rely on the provisions of Recommendation Rec(2004) of the Committee of Ministers is the Council of Europe to member states on the role of the European Convention on Human Rights in university education and vocational training. It has been determined that the constitutional and legal basis for the activities of institutions conducting vocational training of candidates applying for positions of judges is determined by a special law in many countries. It was found that professional training of judges takes place in the formats of a combination of an interdisciplinary approach to training with a multidisciplinary one, the use of various practical methods for teaching, based on the requirements of European legislation, the development of a program to improve the leadership and management skills of candidates applying for positions of judges. It is proposed to take into account the experience of France, Georgia, Poland, Germany, Croatia, the United States of America, Japan, Great Britain, and other countries when forming the corps of professional judges in Ukraine.

Abstract:

Gray & Pape, Inc., of Houston, Texas, on behalf of Lone Star NGL Pipeline, LP, conducted an intensive pedestrian cultural resources survey within permitted areas of the 142.27-kilometer (88.4mile) long Lone Star Express II Pipeline Project – Loop 3, in Eastland, Comanche, Erath, and Bosque Counties, Texas. The lead agency for the project has been identified as the United States Army Corps of Engineers, Fort Worth District (Permit No. SWF-2019-00091). Thus, survey efforts concentrated on areas anticipated to be under the jurisdiction of the United States Army Corps of Engineers (permit areas). Within Loop 3, the total Area of Potential Effects within the permit areas measures approximately 209.9 hectares (518.6 acres). This area encapsulates approximately 52.8 kilometers (32.8 miles) of proposed project alignment. The procedures to be followed by the United States Army Corps of Engineers to fulfill the requirements set forth in the National Historic Preservation Act, other applicable historic preservation laws, and Presidential directives as they relate to the regulatory program of the United States Army Corps of Engineers (33 CFR Parts 320-334) are articulated in the Regulatory Program of the United States Army Corps of Engineers, Part 325 - Processing of Department of the Army Permits, Appendix C - Procedures for the Protection of Historic Properties. All fieldwork and reporting activities were completed according to a scope of work submitted to the United States Army Corps of Engineers and the Texas Historical Commission and accepted standards set forth by the Texas Historical Commission and the Council of Texas Archeologists and in accordance with Section 106 of the National Historic Preservation Act. A records and literature review of the project location prior to survey identified 13 previously recorded archaeological sites, four historic markers, five cemeteries, and five previously conducted surveys within a 0.8-kilometer (0.5-mile) radius of Loop 3. Of those, the mapped locations for one recorded archaeological site and three previous surveys intersect the project corridor. An additional three archaeological sites are located within 91 meters (300 feet) of the project’s Areas of Potential Effects. Fieldwork on Loop 3 was conducted in the Spring of 2019 with supplemental survey in August, October, and November of 2019 and required approximately 3,680-person hours to complete. Survey involved archaeological reconnaissance and shovel testing throughout anticipated permit areas within the project corridor. In total, approximately 901 shovel tests were excavated within permit areas, of which four were positive for cultural material. No portions of previously recorded resources: 41ER48, 41ER49, 41ER50, or 41ER56, were re-identified; however, two new previously unrecorded resources, 41BQ358 and 41BQ359, and one isolate, BQ-07-ISO-01, were discovered. The newly recorded resources consist of sparse Prehistoric lithic scatters, consisting mainly of debitage and lacking temporally or culturally diagnostic artifacts. The lone diagnostic artifact, Isolate BQ-07-ISO-01, consists of an Ellis or Godley type projectile point dating to the Late to Transitional Archaic. The resource areas within the pipeline corridor showed clear disturbance from the adjacent pipeline right-of-way. Indications of soil deflation, erosion, and past land modifications such as agriculture or terracing were also observed. Further, Resource 41BQ358 and Isolate BQ-07-ISO-01 are located on very spatially limited topographic settings surrounded by slopes of 30 degrees or greater. The workspace at the location of 41BQ359 has been revised to avoid the site thus removing it from permitting. The workspace where it passes the site will be marked by orange fencing. Shovel test results at nearly all permit areas identified subsoils, cemented soils, or bedrock. Alarm Creek in Erath County, Permit Area Number 65, was targeted for deep testing based on geomorphological data, and field results and discussions with the field archaeologist. Deep test results indicated a lack of deeply buried A horizon soils and showed no potential for deeply buried cultural material or paleosols. No cultural features or historic-age standing resources were encountered in the field. No artifacts were collected as a result of survey. It is the opinion of Gray & Pape Inc. that none of the recorded resources retain the potential to provide significant research value and are thus recommended not eligible for the National Register, under Evaluation Criterion D. In addition, the resources are recommended not eligible for State Antiquities Landmark status. Gray & Pape, Inc. recommends no additional archaeological work for these resources or surveyed portions of the project. However, Gray & Pape, Inc. recommends that an unanticipated discoveries plan be put into place in the event that such discoveries take place during construction.

Abstract:

Gray & Pape, Inc. was contracted to conduct a cultural resources survey for a proposed pipeline project. The project is a 14-inch pipeline from Praxair Freeport Plant to the Phillips 66 Clemens Storage Cavern located near Freeport, Texas. The project route measures approximately 28.0 kilometers (17.4 miles). The project’s Area of Potential Effect is the entire alignment route within a survey corridor of 91.4 meters (300 feet). This amounts to approximately 252 hectares (622 acres). Subsequent workspace revisions resulted in an additional 25.7 hectares (63.4 acres) or 2.6 kilometers (1.6 miles) of workspace, documented in Appendix C of this final report. The pipeline will be collocated with several existing pipelines in a well-maintained corridor for the entire length. The Project is part of a Nationwide 12 permit for which the Lead Federal Agency is the United States Army Corps of Engineers, Galveston District. The procedures to be followed by the United States Army Corps of Engineers to fulfill the requirements set forth in the National Historic Preservation Act, other applicable historic preservation laws, and Presidential directives as they relate to the regulatory program of the United States Army Corps of Engineers (33 CFR Parts 320-334) are articulated in the Regulatory Program of the United States Army Corps of Engineers, Part 325 -Processing of Department of the Army Permits, Appendix C -Procedures for the Protection of Historic Properties. Approximately 3.6 kilometers (2.25 miles) of the project length is located within property owned by the Texas Department of Criminal Justice, Clemens Prison Unit, which necessitated the procurement of a permit subject to the Antiquities Code of Texas. Permit Number 8666 was assigned to the project on December 4, 2018. As required under the provisions of Texas Antiquities Code Permit, all project records are housed at the Center for Archaeological Studies at Texas State University, San Marcos, Texas. The goals of this study were to assist the client, the Texas Historical Commission, and other relevant agencies in determining whether intact cultural resources were present within areas planned for construction, and if so to provide management recommendations for these resources. All work conducted by Gray & Pape, Inc. followed accepted guidelines and standards set forth by the Texas Historical Commission and the Council of Texas Archeologists. Prior to field investigation, site file research was used to develop a cultural context for the study. This research resulted in a listing of all archaeological sites and National Register properties within 1.6 kilometers (1 mile) of the project area, as well as a discussion of archaeological potential within the tract. Previous surveys conducted by HRA Gray & Pape, LLC and other firms overlap approximately 6.1 kilometers (3.8 miles) / 55.4 hectares (137 acres) of the current project’s corridor. These surveys were undertaken from between 2012 to 2013. These areas along with an additional 2.8 kilometers (2 miles) / 28.9 hectares (71.3 acres) of highly disturbed pipeline corridor were subjected to visual reconnaissance survey only. Another 3.0 kilometers (1.9 miles) / 27.5 hectares (68 acres) of the project is located within highly industrial areas of DOW property and was subjected to desktop assessment and determined to be of low potential for containing intact cultural materials. No further work is recommended for these areas. No new cultural resources were discovered during the survey. Gray & Pape, Inc. recommends no survey within these portions due to the highly disturbed conditions. Intensive pedestrian survey was completed on those portions of the current project that fall outside of the previous survey coverage or that have potential to impact previously unidentified sites. This amounts to 15.6 kilometers (9.7 miles) / 140 hectares (346 acres). As a result of survey efforts, one previously unrecorded archaeological site was identified during survey efforts. As currently mapped, the site is overlapped by an existing pipeline corridor and does not retain integrity within the project right-of-way. Gray & Pape, Inc. recommends that no further investigation be necessary within the surveyed portions of the project.

Abstract:

Background: The Uganda Government, together with development partners, has provided continuing support services (including protection, food, nutrition, healthcare, water and sanitation) to refugee-hosting Districts to successfully manage refugees from different neighbouring countries in established settlements. This service has increased the need for timely and accurate information to facilitate planning, resource allocation and decision-making. Complexity in providing effective public health interventions in refugee settings coupled with increased funding requirements has created demands for better data and improved accountability. Health data management in refugee settings is faced with several information gaps that require harmonisation of the Ugandan National Health Management Information System (UHMIS) and United Nations High Commission for Refugees (UNHCR) Refugee Health Information System (RHIS). This article discusses the rationale for harmonisation of the UNHCR RHIS, which currently captures refugee data, with the UHMIS. It also provides insights into how refugee health data management can be harmonised within a country’s national health management information system. Method: A consultative meeting with various stakeholders, including the Ugandan Ministry of Health, district health teams, representatives from UNHCR, the United Nations Children Education Fund (UNICEF), United States Government and civil society organisations, was held with an aim to review the UHMIS and UNHCR RHIS health data management systems and identify ways to harmonise the two to achieve an integrated system for monitoring health service delivery in Uganda. Results: Several challenges facing refugee-hosting district health teams with regard to health data management were identified, including data collection, analysis and reporting. There was unanimous agreement to prioritise an integrated data management system and harmonisation of national refugee stakeholder data requirements, guided by key recommendations developed at the meeting. Conclusion: This article outlines a proposed model that can be used to harmonise the UNHCR RHIS with the UHMIS. The national refugee stakeholder data requirements have been harmonised, and Uganda looks forward to achieving better health data quality through a more comprehensive national UHMIS to inform policy planning and evidence-based decision-making.

Abstract:

Energy Transfer Company (ETC) is proposing to construct the Orbit Pipeline Project (Project) located in Jefferson, Liberty, and Chambers counties, Texas. The Project consists of approximately 68.7 miles (mi) (110.6 kilometer [km]) of new 20.0-inch (in) (50.8-centimeter [cm]) diameter pipeline that will be used to transmit ethane and propane. The Project is located within the jurisdictional boundary of the United States Army Corps of Engineers (USACE) - Galveston District. At the request of ETC, Perennial Environmental Services, LLC (Perennial) conducted an intensive Phase I cultural resources investigation for the proposed Project to comply with anticipated USACE permitting requirements. Archaeological investigations for the Project were conducted in accordance with Section 106 of the National Historic Preservation Act (NHPA) and Texas State Historical Preservation Office (SHPO) standards. Additionally, the Project traverses several discontinuous publicly-owned tracts that fall under the jurisdiction of the Antiquities Code of Texas (Code). The results of survey investigations conducted under Texas Antiquities Permit (TAP) #8690 (issued December 17, 2018, and amended on August 30, 2019) across six discontinuous publicly -owned tracts are also presented herein. Consistent with USACE application requirements, and in accordance with Section 106 of the NHPA of 1966, as amended (36 CFR 800) and the Code, the proposed Project must make a reasonable and good faith effort to identify historic properties within the Project Area of Potential Effect (APE) and to take into account any potential effects, direct or indirect, the proposed undertaking could have on properties listed or considered eligible for listing in the National Register of Historic Places (NRHP) or for designation as a State Antiquities Landmark (SAL), as warranted. As the Project footprint was not finalized at the time of field investigations, survey efforts were concentrated within the vicinity of delineated wetland and waterbody features along the length of the route within a 300.0-foot- (ft-) (91.4-meter- [m-]) wide Environmental Survey Area (ESA). The anticipated depths of impact for the Project will range from 4.0 to 7.0 ft. (1.2 to 2.1 m) along the pipeline centerline, with limited deeper impacts at horizontal directional drill (HDD) and bore locations, including Cow Island Bayou, Hillebrandt Bayou, Lower Neches Valley River Authority canals, Nolte Canal, the Trinity River, Turtle Bayou, Whites Bayou, Willow Marsh Bayou, and public road crossings. The anticipated depths of impact for temporary workspace areas within the Project APE corridor would not exceed 0.6 to 1.0 ft. (0.1 to 0.3 m). The overall APE for direct effects for the Project measured 2307.19 acres (ac) (933.68 ha), while APE for Code-permitted tracts totaled 210.0 ac (85.06 ha). As presented herein, the Project ESA is coterminous with the Project APE, which is also referred to as the USACE permit areas. Only the areas adjacent to the USACE permit areas and the entirety of Code-permitted areas were surveyed for cultural resources. Jennifer Cochran served as the Principal Investigator, and field efforts were conducted by Sarah Boudreaux, Rafael Cortez, Wyatt Ellison, Rachel Kelley, William Kinkner, Colene Knaub, Jonathan Laird, Alejandro Martinez, and Thomas Ross across multiple field mobilizations between October 1, 2018, and November 12, 2019. Investigations included an archival background review and intensive pedestrian surveys augmented by shovel testing in the vicinity of delineated wetland and waterbody features. Archival research determined that there are no previously recorded sites within, or directly adjacent to the Project APE, and approximately 32.7% of the Project APE has been previously surveyed for cultural resources. However, many of these surveys are outdated and do not meet modern survey standards. Additionally, many of these previously surveys were conducted for USACE-permitted projects, and the entire Project was not surveyed for the presence of cultural resources. As such, all areas surrounding identified wetland and waterbody for this Project were surveyed. Perennial biologists delineated a total of 490 wetland areas. Of the 490 wetlands identified within the Project APE, 290 were characterized as palustrine emergent (PEM) wetlands, 106 were characterized as palustrine forested (PFO) wetlands, 4 were classified as PFO-Cypress wetlands, and 90 were characterized as palustrine scrub-shrub (PSS) wetlands. Perennial biologists also identified 270 waterbodies that ranged from perennial streams to ephemeral streams. Of the 270 waterbodies delineated, 36 were classified as having perennial flow, 66 were classified as having intermittent flow, and 148 were classified as ephemeral flow. Additionally, 20 open water features were delineated and classified as manmade ponds. Survey efforts were concentrated in the vicinity of these features where land access was voluntarily granted in accordance with a scope of work for the Project approved by the USACE on August 28, 2018, and the Texas Historical Commission (THC) on October 1, 2018. Following the approval of the scope of work, ETC extended the eastern terminus of the Project to the western bank of the Neches River, and other minor reroutes were also implemented. Perennial applied the approved survey methodology to all new Project components. For Code-permitted tracts, surveys were conducted across the entire length of the Project APE corridor in accordance with a stand-alone scope submitted to the THC on December 14, 2018, and amended August 30, 2019. Additionally, following the receipt of TAP#8690, the proposed Project was routed onto two additional publicly-owned tracts belonging to the Texas Department of Corrections (DOC) – Stiles Unit and Jefferson County. The TAP #8690 was revised and amended on August 30, 2019. Following this August 30, 2019 amendment, ETC added additional route options across the DOC – Stiles Unit tract. This additional mileage was surveyed using the same methods as stated in the previously presented revised TAP scope of work for this property. In all, the survey investigations included the excavation of a total of 1,250 shovel tests of which 1,171 shovel tests were excavated within the Project APE. The remaining 79 shovel tests were excavated outside of USACE permit areas but within the Project workspace. For the purposes of this report, only investigations within the Project APE will be discussed. Survey investigations within the Project APE resulted in entirely negative findings. No archeological sites were encountered within the survey areas reported herein. Additionally, no historic standing structures or landscape features such as historic-age canals were observed with any USACE permit areas. Overall, the surveys documented predominately inundated landscapes with a low probability for intact cultural resources. Numerous existing pipeline corridors and modern canal features are traversed by the Project. While some of the modern canals could be historic in nature or connected to a greater network of irrigation features used historically to supply agricultural crops with water, it is important to note that the majority of the waterways associated with these features will be bypassed via bore/HDD. As such, any impacts to these waterbodies as well as the associated canal structure will be entirely avoided. Additionally, all visual impacts from the proposed pipeline corridor will be temporary in nature. To date, field surveys have been completed for all accessible wetland and waterbody features along the pipeline route, as well as the total length of the Project survey corridor across all Codepermitted tracts. Prior to the beginning of November 2019, field surveys had not been conducted along the eastern banks and associated bottomlands of the Trinity River due to multiple flooding events that resulted in heavy inundation beginning in September 2018 which prevented access or survey investigations of any kind. Additionally, field surveys did not occur along portions of the Project containing denied landowner permissions. On November 6, 2019, a survey crew was able to access previously inaccessible areas associated with the Trinity River due to several months of normalized weather conditions throughout portions of Eastern Texas. Even under normal conditions, large portions of this area remain constantly inundated due to strong hydrological influences and the geomorphic position of the landscape. However, crews were able to traverse inundated areas by foot to access portions of the Project located immediately adjacent to the Trinity River. While the area located immediately adjacent to the Trinity River was not inundated at the time of survey, wetlands with strong hydrological indicators still dominate the landscape. Of the 760 delineated wetland and waterbody features, 74 features were originally not surveyed for cultural resources due to restricted land access including denied landowner permissions and significant inundation. Of these 74 features, 38 feature locations (27 streams and 42 wetlands) will be bypassed via horizontal directional drill (HDD) or bore trenchless construction methods resulting in no impacts to these features. The remaining five features (including multiple crossing locations of the same feature) are located along the eastern banks of the Trinity River. While these features were surveyed for cultural resources with negative findings, the presence of buried deposits exists within the vicinity of these features. However, access to these features with heavy machinery is not feasible due to the remote location and constant hydrological influences (e.g. inundation and saturation) associated with the floodplain setting of the Trinity River. As such, these five features are proposed to be monitored by a qualified Archeological Monitor during construction efforts. Appendix C provides each wetland and waterbody feature crossed by the Project with management recommendations and associated comments, while Appendix F provides a Cultural Monitoring Plan to evaluate the five features that will not be avoided during construction efforts. Appendix F also includes a table in response to a letter issued by the USACE Staff Archeologist, Mr. Jerry Androy, on May 17, 2019, indicating that the 74 aforementioned permit areas associated with the Project would require cultural resources investigations. The table lists each permit area, the reason surveys were not originally conducted, and justification for/against the need for monitoring. Based on the results of the survey effort reported here, no cultural resources will be affected by any construction activities within the Project APE. Aside from Cultural Monitoring at five features (including multiple crossing locations of the same feature) within the Trinity River floodplain, it is Perennial’s opinion that no further cultural resources investigations are warranted for the Project. Should archaeological remains be encountered during construction, work in the immediate area will cease, and a qualified archaeologist will be called upon to evaluate the remains and provide recommendations for how to manage the resources under the State’s Historic Preservation Plan.

Abstract:

The United States Forest Service (USFS) is proposing to reconstruct perimeter fencing surrounding three Grasslands units located within the Lyndon B. Johnson National Grassland (LBJ National Grassland) in Wise County, Texas. As part of the proposed perimeter fence reconstruction within the three proposed Grasslands units, the USFS is seeking a general inventory of cultural resources which includes background and historic research, archeological field survey, site delineation, a determination of the condition of recorded cultural resources, and recommendation of eligibility for listing on the National Register of Historic Places (NRHP) of any sites encountered. The overall project tracts are subject to federal jurisdiction and falls under the regulations of Section 106 of the National Historic Preservation Act (NHPA) of 1966, as amended (U.S. Code 16, §470, et seq.). To ensure compliance with Section 106 of the NHPA, the USFS contracted with TRC Environmental Corporation (TRC) to conduct any necessary field investigations required as determined during the coordination process. The Area of Potential Effects (APE) consists of three Grasslands units where proposed perimeter fence reconstruction will occur. The three Grasslands units include Unit 48, Unit 62, and Unit 63. Together, the three Grasslands units measure 399 acres. A cultural resources survey of these three Grasslands units was performed under Section 106 of the NHPA. For these investigations, Josh Haefner served as the Principal Investigator and Steve Sarich was the Project Archeologist. Field work was conducted by Josh Haefner, Steve Sarich, Benjamin Johnson, Gregg Cestaro, and Haley Wilkerson, the latter two individuals employed by Hicks & Company, the small-business subconsultant for this project. Results of the background review, completed prior to the field investigation determined that one previously recorded site, 41WS105, is located within the APE; no cemeteries or historic structures were noted within the APE; while one previous cultural resources survey has been performed within or within the vicinity of the APE. This previous survey was a limited seismic survey of Unit 48 and resulted in the discovery of 41WS105. Prior to survey, TRC coordinated with the USFS on the proposed survey methodology and research design. TRC archeologists performed survey supplemented with shovel testing at the three Grasslands units on October 31– November 08 and December 04 – 06, 2019. During the investigations, a total of 412 shovel tests were excavated. Of these tests, 405 were negative for cultural materials. In addition to these tests 65 points were recorded as “No Dig” locations due to ground disturbance, slope, or other impediment. Seven shovel tests were positive for cultural materials. Three new sites were recorded within the APE and an extension to previously recorded 41WS105 (forest service number: 08130800055) was delineated as a result of the survey. As shovel testing at two of the new sites, 41WS160 (08130800526) and 41WS161 (08130800527), noted no buried cultural deposits and historic cultural materials were observable on the ground surface, these boundaries were established by the mapping of the horizontal distribution of artifacts along the ground surface. Boundaries for the 41WS105 and 41WS159 (08130800525) were based on both the distribution of positive shovel tests and the presence of cultural materials on the ground surface. Based on the results of the cultural resources survey, TRC recommends that no further investigations are necessary and the project may proceed as planned with no historic properties affected.

Abstract:

We Break Up, I Publish: Theorising and Emotional Processing like Taylor Swift In 2007 after the rather painful end of my first long-term same-sex relationship I asked myself two questions (and like a good graduate student wrote a paper about it that was subsequently published): (1) what is love; (2) and if love exists, are queer and straight love somehow different. I asked myself the second question because, unlike my previous “straight” breakups (back when I honestly thought I was straight), this one was different, was far more messy, and seemed to have a lot to do with the fact that my then fresh ex-boyfriend and I had dramatically different ideas about how the relationship should look, work, be codified, or if it should or could be codified. It was an eye-opening experience since the truth that these different ideas existed—basically his point of view—really only “came out” in my mind through the act and learning involved in that breakup. Until then, from a Queer Theory perspective, you could have described me as a “man who had sex with men,” called himself hom*osexual, but was so hom*onormative that if you’d approached me with even a light version of Michel Foucault’s thoughts on “Friendship as a Way of Life” I’d have looked at you as queerly, and cluelessly, as possible. Mainstream Queer Theory would have put the end of the relationship down to the difference and conflict between what is pejoratively called the “marriage-chasing-Gay-normaliser,” represented by me, and the “radical-Queer(ness)-of-difference” represented by my ex-boyfriend, although like a lot of theory, that misses the personal (which I recall being political...), and a whole host of non-theoretical problems that plagued that relationship. Basically I thought Queer/hom*osexual/Lesbian/Transgendered and the rest of the alphabet soup was exactly the same as Straight folks both with respect to a subjective understanding of the self, social relations and formations, and how you acted or enacted yourself in public and private except in the bedroom.. I thought, since Canada had legalised same-sex marriage, all was well and equal (other than the occasional hate-crime which would then be justly punished). Of course I understood that at that point Canada was the exception and not the rule with respect to same-sex rights and same-sex marriage, so it followed in my mind that most of our time collectively should be spent supporting those south of the border or overseas who still faced restrictions on these basic rights, or out-and-out violence, persecution and even state-sanctioned death for just being who they are and/or trying to express it. And now, five years on, stating that Canada is the exception as opposed to the rule with respect to the legalisation of same-sex marriage and the codification of same-sex rights in law has the potential to be outdated as the recent successes of social movements, court rulings and the tenor of political debate and voting has shifted internationally with rapid speed. But it was only because of that breakup that these theoretical and practical issues had come out of my queer closet and for the first time I started to question some necessary link between love and codification (marriage), and how the queer in Queer relationships does or potentially can disrupt this link. And not just for Queers, but for Straight folk too, which is the primary point that should be underlined now and is addressed at the end of this paper. Because, embittered as I was at the time, I still basically agree with the theoretical position that I came to in that paper on love—based on a queering of the terms of Alain Badiou—where I affirmed that love resisted codification, especially in its queer form, because it is fidelity to an act and truth between two or more partners which resists the rigid walls of State-based codification (Potts, Love Hurts; Badiou, Ethics and Saint Paul). But as one of the peer reviewers for this paper rightly pointed out, the above distinctions between my ex and myself implicitly rely upon a State-centric model of rights and freedoms, which I attacked in the first paper, but which I freely admit I am guilty of utilising and arguing in favour of here. But that is because I am interested, here, not in talking about love as an abstract concept towards which we should work in our personal relationships, but as the state of things, and specifically the state of same-sex marriage and the discourse and images which surrounds it, which means that the State does matter. This is specifically so given the lack of meaningful challenges to the State System in Canada and the US. I maintain, following Butler, that it is through power, and our response to the representatives of power “hailing us,” that we become bodies that matter and subjects (Bodies That Matter; The Psychic Life of Power; and Giving An Account of Oneself). While her re-reading of Althusser in these texts argues that we should come to a philosophical and political position which challenges this State-based form of subject creation and power, she also notes that politically and philosophically we have yet to articulate such a position clearly, and I’d say that this is especially the case for what is covered and argued in the mainstream (media) debate on same-sex marriage. So apropos what is arguably Foucault’s most mature analysis of “power,” and while agreeing that my State-based argument for inclusion and rights does indeed strengthen the “biopolitical” (The History of Sexuality 140 and 145) control over, in this case, Queer populations, I argue that this is nonetheless the political reality with which we are working in and analyzing, and that is my concern here. Despite a personal desire that this not be the case, the State or state sanctioned institutions do continue to hold a monopoly of power in conferring subjecthood and rights. To take a page from Jeremy Bentham, I would say that arguing from a position which does not start from or seriously consider the State as the current basis for rights and subjecthood, though potentially less ethically problematic and more in line with my personal politics, is tantamount to talking and arguing about “nonsense on stilts.” “Caught in a Bad Romance?” Comparing hom*onationalist Trajectories and the Appeal of Militarist Discourse to LGBT Grassroots Organisations In comparing the discourses and enframings of the debate over same-sex marriage between Canada in the mid 1990s and early 2000s and in the US today, one might presume that how it came to say “I do” in Canada and how it might or might not get “left at the altar” in the US, is the result of very different national cultures. But this would just subscribe to one of a number of “cultural explanations” for perceived differences between Canada and the US that are usually built upon straw-man comparisons which then pillorise the US for something or other. And in doing so it would continue an obscuration that Canada, unlike the US, is unproblematically open and accepting when it comes to multicultural, multiracial and multisexual diversity and inclusion. Which Canada isn’t nor has it ever been. When you look at the current discourse in both countries—by their key political representatives on the international stage—you find the opposite. In the US, you have President Barack Obama, the first sitting President to come out in favour of same-sex marriage, and the Secretary of State, Hillary Clinton, setting same-sex rights at home and abroad as key policy planks (Gay Rights are Human Rights). Meanwhile, in Canada, you have Prime Minister Stephen Harper, in office since 2006, openly support his Conservative Party’s “traditional marriage” policy which is thankfully made difficult to implement because of the courts, and John Baird, the badly closeted Minister of Foreign Affairs, who doesn’t mention same-sex rights at home or with respect to foreign relations—unless it is used as supplementary evidence to further other foreign policy goals (c.f. Seguin)—only showing off his sexuality outside of the press-gallery to drum up gay-conservative votes or gay-conservative fundraising at LGBTQ community events which his government is then apt to pull funding for (c.f. Bradshaw). Of course my point is not to just reverse the stereotypes, painting an idyllic picture of the US and a grim one of Canada. What I want to problematise is the supposed national cultural distinctions which are naturalised when arguments are made through them as to why same-sex marriage was legalised in Canada, while the Defense of Marriage Act still stands in the US. To follow and extend Jasbir Puar’s argument from Terrorist Assemblages, what we see in both same-sex marriage debates and discourses is really the same phenomenon, but, so far, with different outcomes and having different manifestations. Puar contends that same-sex rights, like most equalising rights for minority groups, are only granted when all three of the following conditions prevail: (1) in a state or narrative of exception, where the nation grants a minority group equal rights because “the nation” feels threatened from without; (2) only on the condition that normalisation (or hom*onormalisation in the case of the Queer community) occurs, with those who don’t conform pushed further from a place in the national-subject; (3) and that the price of admission into being the “allowed Queer” is an ultra-patriotic identification with the Nation. In Canada, the state or narrative of exception was an “attack” from within which resulted in the third criterion being downplayed (although it is still present). Court challenges in a number of provinces led in each case to a successful ruling in favour of legalising same-sex marriage. Appeals to these rulings made their way to the Supreme Court, who likewise ruled in favour of the legalisation of same-sex marriage. This ruling came with an order to the Canadian Parliament that it had to change the existing marriage laws and definition of marriage to make it inclusive of same-sex marriage. This “attack” was performed by the judiciary who have traditionally (c.f. Makin) been much less partisan in appointment or ruling than their counterparts in the US. When new marriage laws were proposed to take account of the direction made by the courts, the governing Liberal Party and then Prime Minister Paul Martin made it a “free vote” so members of his own party could vote against it if they chose. Although granted with only lacklustre support by the governing party, the Canadian LGBTQ community rejoiced and became less politically active, because we’d won, right? International Queers flocked to Canada—one in four same-sex weddings since legalisation in Canada have been to out of country residents (Postmedia News)—as long as they had the proper socioeconomic profile (which is also a racialised profile) to afford the trip and wedding. This caused a budding same-sex marriage tourism and queer love normalisation industry to be built around the Canada Queer experience because especially at the time of legalisation Canada was still one of the few countries to allow for same-sex marriages. What this all means is that hom*onationalism in Canada is much less charged. It manifests itself as fitting in and not just keeping up with the Joneses when it comes to things like community engagement and Parent Teacher Association (PTA) meetings, but trying to do them one better (although only by a bit so as not to offend). In essence, the comparatively bland process in the 1990s by which Canada slowly underwent a state of exception by a non-politically charged and non-radical professional judiciary simply interpreting the Canadian Charter of Rights and Freedoms at the provincial and then the federal level is mirrored in the rather bland and non-radical hom*onationalism which resulted. So unlike the US, the rhetoric of the LGBT community stays subdued unless there’s a hint that the right to same-sex divorce might get hit by Conservative Party guns, in which case all hell breaks loose (c.f. Ha). While the US is subject to the same set of logics for the currently in-progress enactment of legalising same-sex marriage, the state of exception is dramatically different. Puar argues it is the never-ending War on Terror. This also means that the enframings and debate in the US are exceptionally charged and political, leading to a very different type of hom*onationalism and hom*onationalist subject than is found in Canada. American hom*onationalism has not radically changed from Puar’s description, but due to leadership from the top (Obama, Clinton and Lady Gaga) the intensity and thereby structured confinement of what is an acceptable Queer-American subject has become increasingly rigid. What is included and given rights is the hyper-patriotic queer-soldier, the defender of the nation. And what reinforces the rigidity of what amounts to a new “glass closet” for queers is that grassroots organisations have bought into the same rhetoric, logic, and direction as to how to achieve equality as the Homecoming advertisem*nt from the Equal Love Campaign in Britain shows. For the other long-leading nation engaged in the War on Terror narrative, Homecoming provides the imagery of a gay member of the armed services draped in the flag proposing to his partner at the end of duty overseas that ends with the following text: “All men can be heroes. All men can be husbands. End discrimination.” Can’t get more patriotic—and heteronormative with the use of the term “husbands”—than that. Well, unless you’re Lady Gaga. Now Lady Gaga stands out as a public figure whom has taken an explicitly pro-queer and pro-LGBT stance from the outset of her career. And I do not want to diminish the fact that she has been admirably effective in her campaigning and consistent pro-queer and pro-LGBT stance. While above I characterised her input above as leadership from the top, she also, in effect, by standing outside of State Power unlike Obama and Clinton, and being able to be critical of it, is able to push the State in a more progressive direction. This was most obviously evidenced in her very public criticism of the Democratic Party and President Obama for not moving quickly enough to adopt a more pro-queer and pro-LGBT stance after the 2008 election where such promises were made. So Lady Gaga plays a doubled role whereby she also acts as a spokesperson for the grassroots—some would call this co-opting, but that is not the charge made here as she has more accurately given her pre-existing spotlight and Twitter and Facebook presence over to progressive campaigns—and, given her large mainstream media appeal and willingness to use this space to argue for queer and LGBT rights, performs the function of a grassroots organisation by herself as far as the general public is concerned. And in her recent queer activism we see the same sort of discourse and images utilised as in Homecoming. Her work over the first term of Obama’s Presidency—what I’m going to call “The Lady Gaga Offensive”—is indicative: she literally and metaphorically wrapped herself in the American flag, screaming “Obama, ARE YOU LISTENING!!! Repeal ‘Don’t Ask, Don’t Tell’ and [have the hom*ophobic soldiers] go home, go home, go home!” (Lady Gaga Rallies for Repeal of Don’t Ask, Don’t Tell). And presumably to the same home of otherness that is occupied by the terrorist or anything that falls under the blanket of “anti-American” in Puar’s critique of this approach to political activism. This speech was modelled on her highly successful one at the National Equality March in 2009, which she ended with “Bless God and Bless the Gays.” When the highly watched speeches are taken together you literally can’t top them for Americanness, unless it is by a piece of old-fashioned American apple-pie bought at a National Rifle Association (NRA) bake-sale. And is likely why, after Obama’s same-sex “evolution,” the pre-election ads put out by the Democratic Party this year focused so heavily on the repeal of “Don’t Ask, Don’t Tell” and the queer patriotic soldier or veteran’s obligation to or previous service in bearing arms for the country. Now if the goal is to get formal and legal equality quickly, then as a political strategy, to get people onside with same-sex marriage, and from that place to same-sex rights and equal social recognition and respect, this might be a good idea. Before, that is, moving on to a strategy that actually gets to the roots of social inequality and doesn’t rely on “hate of ‘the other’” which Puar’s analysis points out is both a byproduct of and rooted in the base of any nationalist based appeal for minoritarian rights. And I want to underline that I am here talking about what strategy seems to be appealing to people, as opposed to arguing an ethically unproblematic and PC position on equality that is completely inclusive of all forms of love. Because Lady Gaga’s flag-covered and pro-military scream was answered by Obama with the repeal of “Don’t Ask, Don’t Tell” and the extension of some benefits to same-sex couples, and has Obama referring to Gaga as “your leader” in the pre-election ads and elsewhere. So it isn’t really surprising to find mainstream LGBT organisations adopting the same discourse and images to get same-sex rights including marriage. One can also take recent poll numbers from Canada as indicative as well. While only 10 percent of Canadians have trust in political parties, and 17 and 16 percent have trust in Parliament and Prime Minister Harper respectively, a whopping 53 percent have trust in the Canadian Forces (Leblanc). One aspect that undergirds Puar’s argument is that especially at a "time of war," more than average levels of affection or trust is shown for those institutions that defend “us,” so that if the face of that institution is reinscribed to the look of the hyper-patriotic queer-soldier (by advertising of the Homecoming sort which is produced not by the State but by grassroots LGBT organisations), then it looks like these groups seem to be banking that support for Gays and Lesbians in general, and same-sex marriage in specific, will further rise if LGBT and Queer become substantively linked in the imagination of the general public with the armed forces. But as 1980s Rockers Heart Asked: “But There’s Something That You Forgot. What about Love?” What these two hom*onationalist trajectories and rhetorics on same-sex marriage entirely skip over is how exactly you can codify “love.” Because isn’t that the purpose of marriage? Saying you can codify it is like grasping at a perfectly measured and exact cubic foot of air and telling it to stay put in the middle of a hurricane. So to return to how I ended my earlier exploration of love and if it could or should be codified: it means that as I affirm love, and as I remain in fidelity to it, I subject myself in my fundamental weakness constantly to the "not-known;" to constant heartbreak; to affirmations which I cannot betray as it would be a betrayal of the truth process itself. It's as if at the very moment the Beatles say the words 'All you need is love' they were subjected to wrenching heartbreak and still went on: 'All you need is love...' (Love Hurts) Which is really depressing when I look back at it now. But it was a bad breakup, and I can tend to the morose in word choice and cultural references when depressed. But it also remains essentially my position. If you impose “till death or divorce do us part” on to love you’re really only just participating in the chimera of static love and giving second wind to a patriarchal institution which has had a crappy record when it comes to equality. It also has the potential to preserve asymmetrical roles “traditional marriage” contains from when the institution was only extended to straight couples. And isn’t equality the underlying philosophical principle and political position that we’re supposedly fighting for if we’re arguing for an equal right to get married? Again, it’s important to try and codify the same rights for everyone through the State at the present time because I honestly don’t see major changes confronting the nation state system in Canada or the US in the near future. We remain the play-children of a digitally entrenched form of Foucaultian biopower that is State and Capital directed. Because while the Occupy Wall Street movements got a lot of hay in the press, I’ve yet to see any substantive or mainstreamed political change come out of them—if someone can direct me to their substantive contribution to the recent US election I’d be happy to revise my position—which is likely to our long term detriment. So this is a pragmatic analysis, one of locating one node in the matrices of power relations, of seeing how mainstream LGBT political organisations and Lady Gaga are applying the “theoretical tool kits” given to us by Foucault and Puar, and seeing how these organisations and Gaga are applying them, but in this case in a way that is likely counter to authorial intention(s) and personal politics (Power/Knowledge 145, 193; Terrorist Assemblages). So what this means is that we’re likely to continue to see, in mainstream images of same-sex couples put out by grassroots LGBT organisations, a hom*onationalism and ideological construction that grows more and more out of touch with Queer realities—the “upper-class house-holding PTA Gay”; although on a positive note I should point out that the Democratic Party in the US seems to be at least including both white and non-white faces in their pre-election same-sex marriage ads—and one that most Queers don’t or can’t fit themselves into especially when it comes down to the economic aspect of that picture, which is contradictory and problematic (c.f. Christopher). It also means that in the US the hom*onationalism on the horizon looks the same as in Canada except with a healthy dose of paranoia of outsiders and “the other” and a flag draped membership in the NRA, that is, for when the queer super-soldier is not in uniform. It’s a straightjacket for a closet that is becoming smaller because it seeks, through the images projected, inclusion for only a smaller and smaller social sub-set of the Lesbian and Gay community and leaves out more and more of the Queer community than it was five years ago when Puar described it. So instead of trying to dunk the queer into the institution of patriarchy, why not, by showing how so many Queers, their relationships, and their loving styles don’t fit into these archetypes help give everyone, including my “marriage-chasing-Gay-normaliser” former self a little “queer eye, for all eyes.” To look at and see modern straight marriage through the lenses and reasons LGBT and Queer communities (by-and-large) fought for years for access to it: as the codification and breakdown of some rights and responsibilities (i.e. taking care of children); as an act which gives you straightforward access to health benefits and hospital visitation rights; as an easy social signifier for others of a commitment to another person that doesn’t use diluted language like “special friend;” and because when it comes down to it that “in sickness and in health” part of the vow—in the language of a queered Badiou, a vow can be read as the affirmation of a universal and disinterested truth (love) and a moment which can’t be erased retrospectively, say, by divorce—seems like a sincere way to value at least one of those you really care for in the world. And hopefully it, as a side-benefit, it acts as a reminder but is not the actuality of that first fuzzy feeling which (hopefully) doesn’t go away. But I learned my lesson the first time and know that the fuzzy feeling might disappear as it often does. It doesn’t matter how far we try and cram it into any variety of hom*onationalist closets, since it’ll always find a way to not be there, no matter how tight you thought you’d locked the door to keep it in for good if it wants out. Because you can’t keep emotions by contract: so at the end of the day the logical, ethical and theoretically sound position is to argue for the abolition of marriage as an institution. However, Plato and others have been making that argument for thousands of years, and it still doesn’t seem to have gained popular traction. And we also need to realise, contrary to the opinion of my former self and The Beatles, that you really do need more than love as fidelity to an event of you and your partner’s making when you are being denied your partners health benefits just because you are a same-sex couple, especially when those health benefits could be saving your life. And if same-sex marriage codification is a quick fix for that and similar issues for those who can fit into the State sanctioned same-sex marriage walls, which admittedly leaves some members of the Queer community who don’t overlap out, as part of an overall and more inclusive strategy that does include them then I’m in favour of it. That is, till the time comes that Straight and Queer can, over time and with a lot of mutual social learning, explore how to recognise and give equal rights with or without State based codification to the multiple queer and sometimes polyamorous relationship models that already populate the Gay and Straight worlds right now. So in the meantime continue to count me down as a “marriage-chasing-Gay.” But just pragmatically, not to normalise, as one of a diversity of political strategies for equality and just for now. References Badiou, Alain. Ethics: An Essay on the Understanding of Evil. New York: Verso, 2001. ———. Saint Paul: The Foundation of Universalism, Stanford: Stanford UP, 2003. Bradshaw, James. “Pride Toronto Denied Federal Funding.” The Globe and Mail. 7 May. 2012 ‹http://www.theglobeandmail.com/news/toronto/pride-toronto-denied-federal-funding/article1211065/›. Butler, Judith. Gender Trouble: Feminism and the Subversion of Identity. New York: Routledge,1990. ———. Bodies That Matter: On the Discursive Limits of “Sex”. New York: Routledge, 1993. ———. Excitable Speech: A Politics of the Performative. New York: Routledge, 1997. ———. The Psychic Life of Power: Theories of Subjection. Stanford: Stanford UP, 1997. ———. Giving an Account of Oneself. New York: Fordham UP, 2005. Christopher, Nathaniel. “Openly Gay Men Make Less money, Survey Shows.” Xtra! .5 Nov. 2012 ‹http://www.xtra.ca/public/Vancouver/Openly_gay_men_make_less_money_survey_shows-12756.aspx›. Clinton, Hillary. “Gay Rights Are Human Rights, And Human Rights Are Gay Rights.” United Nations General Assembly. 26 Dec. 2011 ‹http://thinkprogress.org/lgbt/2011/12/06/383003/sec-clinton-to-un-gay-rights-are-human-rights-and-human-rights-are-gay-rights/?mobile=nc›. Foucault, Michel. Power/Knowledge: Selected Interviews and Other Writings 1972-1977. Ed. Colin Gordon. Trans. Colin Gordon, Leo Marshall, John Mepham, Kate Soper. New York: Random House,1980. —. Discipline and Punish: The Birth of the Prison. Trans. Alan Sheridan. Toronto: Random House, 1977. —. The History of Sexuality Volume One: An Introduction. Trans. Robert Hurley. New York: Random House, 1978. Heart. “What About Love.” Heart. Capitol Records, 1985. CD. Ha, Tu Thanh. “Dan Savage: ‘I Had Been Divorced Overnight’.” The Globe and Mail. 12 Jan. 2012 ‹http://www.theglobeandmail.com/news/politics/dan-savage-i-had-been-divorced-overnight/article1358211/›. “Homecoming.” Equal Love Campaign. ‹http://www.youtube.com/watch?v=a54UBWFXsF4›. Leblanc, Daniel. “Harper Among Least Trusted Leaders, Poll Shows.” The Globe and Mail. 12 Nov. 2012 ‹http://www.theglobeandmail.com/news/politics/harper-among-least-trusted-leaders-poll-shows/article5187774/#›. Makin, Kirk. “The Coming Conservative Court: Harper to Reshape Judiciary.” The Globe and Mail. 24 Aug. 2012 ‹http://www.theglobeandmail.com/news/politics/the-coming-conservative-court-harper-to-reshape-judiciary/article595398/›. “Lady Gaga Rallies for Repeal of ‘Don’t Ask, Don’t Tell’ in Portland, Maine.” 9 Sep. 2010 ‹http://www.youtube.com/watch?v=g4rGla6OzGc›. “Lady Gaga Speaks at Gay Rights Rally in Washington DC as Part of the National Equality March.” 11 Oct. 2009 ‹http://www.youtube.com/watch?v=7jepWXu-Z38›. “Obama’s Stirring New Gay Rights Ad.” Newzar.com. 24 May. 2012 ‹http://newzar.com/obamas-stirring-new-gay-rights-ad/›. Postmedia News. “Same-sex Marriage in Canada will not be Revisited, Harper Says.” 12 Jan. 2012 ‹http://news.nationalpost.com/2012/01/12/same-sex-marriage-in-canada-will-not-be-revisited-harper-says/›. Potts, Graham. “‘Love Hurts’: Hunter S. Thompson, the Marquis de Sade and St. Paul Queer Alain Badiou’s Truth and Fidelity.” CTheory. rt002: 2009 ‹http://www.ctheory.net/articles.aspx?id=606›. Puar, Jasbir. Terrorist Assemblages: hom*onationalism in Queer Times. London: Duke UP, 2007. Seguin, Rheal. “Baird Calls Out Iran on Human Rights Violations.” The Globe and Mail. 22 Oct. 2012 ‹http://www.theglobeandmail.com/news/politics/baird-calls-out-iran-on-human-rights-violations/article4628968/›.

Abstract:

BOB Hydrographics, LLC conducted a marine archaeological assessment for portions of the Bluewater SPM Project proposed in Nueces and Aransas counties and adjoining federal waters. These archaeological investigations were sponsored by Lloyd Engineering, Inc. on behalf of Bluewater Texas Terminal, LLC. The marine portion of this project comprises two segments: Offshore and Inshore. The Inshore project corridor parallels the Aransas Ship Channel from the community of Aransas Pass to Harbor Island, crossing portions of State Mineral Lease Tracts 309, 310, 313, 314 in Corpus Christi Bay, and then crosses beneath the Lydia Ann Channel to San Jose Island, including a portion of Tract 306 in Aransas Bay. The Offshore project corridor crosses portions of State Mineral Lease Tracts 693, 694, 695 (same as MI-695), 721, 836, 837, 838, 839, 844, 845, 846, 847, 848, 849, 850, and 851 on the Gulf side of San Jose Island, and then crosses portions of Federal Lease Blocks MI-695, MI-696, MI-697, MI-698, and MI-699. The marine Area of Potential Effect (APE) is a 2,000-foot-wide corridor, offshore of San Jose Island, and a 1,000-foot-wide corridor, inshore of San Jose Island. Both Inshore and Offshore APEs are centered on the construction right-of-way and include the proposed lay barge anchorage. The APE totals 7,174 acres, including 3,079 acres in federal waters and 4,095 acres in state waters. The APE in state waters totals 288 acres Inshore and 3,807 acres Offshore in the Gulf of Mexico. Water depth ranges from 2-30 feet (ft) Inshore and from 0-92 ft Offshore. The Project proposes construction of a Deepwater Port (DWP) with two single point mooring (SPM) buoys and associated pipelines. The DWP would be located 17.3 miles offshore of San Jose Island in approximately 89.5 ft of water. The DWP would allow simultaneous loading of two Very Large Crude Carrier tankers with domestic crude oil via two 30-inch sub-marine pipelines. Pipes will be directionally drilled beneath all shorelines and Inshore waterways. Offshore pipes will be buried by a jetting sled to a depth of 6-7 ft below the seafloor with 36 inches of cover. The sled will discharge sediment back into the trench to facilitate backfilling. Subsea pipes will be separated by 10-15 ft, horizontally, within a proposed 75-ft-wide construction right-of-way. Offshore pipes will be installed from a conventional pipelay barge with an 8-point anchor system (using 4 at a time). Inshore pipes will be directionally drilled beneath all bay waters. The purpose of this study was to assess the potential for submerged archaeological sites in the APE; however, no artifacts were collected during the survey. Submerged archaeological sites, in this context, might be historic sites, such as sunken or abandoned watercraft; or drowned terrestrial prehistoric sites dating to the late Pleistocene or Early Holocene when the APE was last above sea level. A review of the cultural background determined that 11 marine archaeological investigations have been conducted within 3 miles of this project. At least, 95 wrecks have been reported within 3 miles of the APE. Geophysical survey was completed by Naismith Marine Services, Inc. from January 4 through April 19, 2019 under Texas Antiquities Permit 8672. A variety of equipment was used to conduct the marine survey, depending on water depths, including multi- and single-beam echo sounders, a sub-bottom profiler, sidescan sonar, and a magnetometer. Archaeologists monitored the acquisition of all data in state waters. Analysis of geophysical survey results from this investigation discovered three significant targets, including one in federal waters (Anomaly 1), and two in state waters (anomalies 2 and 3). All three targets are potentially eligible for the National Register of Historic Places and are recommended for avoidance. The two targets in state waters also may be eligible as State Antiquities Landmarks. Anomaly 2, is confirmed as a shipwreck by sonar imagery and is designated as an archaeological site, 41AS119. No potential historic sites were discovered by the Inshore survey. There is low potential for the presence of intact prehistoric sites in the Offshore APE. The top of the Beaumont Formation is exposed at the seafloor between the 31- ft and 46-ft isobaths and is buried by Holocene sediments to varying depths beneath the remainder of the survey corridor. This former land surface had little protection from wave energy during sea-level rise and is still actively eroding along portions of the APE where exposed. The Texas Historical Commission did not require sub-bottom data in the bay, so areas of high potential for submerged prehistoric sites were not mapped there. This study was completed in compliance with Section 106 of the National Historic Preservation Act (Public Law 89-665; 16 U.S.C. 470) and the Antiquities Code of Texas (Texas Natural Resource Code, Title 9, Chapter 191). The minimum reporting and survey requirements for marine archaeological studies conducted under a Texas Antiquities Permit are mandated by The Texas Administrative Code, Title 13, Part 2, Chapters 26 and 28, respectively. The petroleum industry is regulated in federal waters, beyond 9 nautical miles offshore, by the Bureau of Ocean Energy Management (BOEM), an agency of the United States Department of the Interior. This study also complies with archaeological requirements published by BOEM in their Notice to Lessees 2005-G07. Archaeological project records are curated at the Center for Archeological Study at Texas State University in San Marcos.

Abstract:

The year 2016 was an important year for Slovenia from various different aspects. Twenty-five years have passed since Slovenia gained its independence, and for the same time period, the country has been taking care of its own security independently. As early as in 1990, the Slovenians started preparing for the big changes ahead. Two events from that time need mentioning, namely the plebiscite at the end of the year, which was important to all other activities undertaken the following year, and the historic date of 25 June 1991, when the Declaration of Independence and the Basic Constitutional Charter on the Sovereignty and Independence of the Republic of Slovenia were adopted. Slovenia’s sovereignty and independence were declared the following day. On 27 June, Slovenia’s War of Independence, which lasted for ten days, began with an attack launched by the Yugoslav People’s Army. In 1992, Slovenia joined the Organisation for Security and Cooperation in Europe (OSCE) and became the 176th member of the United Nations. The democratically expressed will for accession to NATO was first clearly expressed in the amendments to the Resolution on the Guidelines for National Security in 1994. That was when Slovenia joined the Partnership for Peace programme, which initiated the journey to join that political and security organisation. In 2003, the Slovenians decided in two consultative referendums that we wanted to create our future and safety as members of the European Union and NATO. On 29 March, Slovenia became a NATO member state, and on 1 May, it also became a member of the European Union. The events and activities listed above are a testament to the successful development of Slovenia as an independent state, whose large amount of energy and mutual cooperation, as well as successful foreign policy and quality diplomacy, helped make remarkable progress on its rather short development path. Some above-mentioned activities from the fields of foreign policy and diplomacy also affect the fields of defence and armed forces. There have been numerous significant milestones in the development of the Slovenian Armed Forces. On this occasion, I should mention 15 May 1991, when the first Slovenian conscripts started their military service on their home soil, namely in Ig near Ljubljana and in Pekre near Maribor. At the end of 1994, the Defence Act was adopted by a two-thirds majority vote, which, among other things, signified the end of the Territorial Defence and the beginning of the Slovenian Armed Forces with a capital S. In May 1995, the decision was taken to make 15 May the Day of the Slovenian Armed Forces. In 1997, members of the Slovenian Armed Forces were deployed to the military and humanitarian ALBA operation for the first time. From then to the end of 2016, Slovenia contributed greatly to international security, since during that period, 11,357 members of the Slovenian Armed Forces were deployed to international operations and missions. In 2003, the last generation of conscripts served their compulsory military service; after that, the Slovenian Armed Forces changed to a professional army with contractual reserves. A year later, when Slovenia became a member of NATO, the first members of the Slovenian Armed Forces left for the international ISAF operation and mission in Afghanistan. Anton Grizold and Alojz Šteiner have written before on the subject of development periods of military defence after Slovenia gained independence. Šteiner divides the development of the Slovenian Armed Forces into four periods: the period between 1991 and 1994, which he calls the Territorial Defence period; the period between 1995 and 1999, which saw the reorganisation of the Slovenian Armed Forces and the beginning of international military cooperation; the period between 2000 and 2004, which he defines as the time of preparations for entry into NATO and the beginning of professionalisation and transformation of the Slovenian Armed Forces; and the period between 2005 and 2010, which was characterised by the integration into NATO and the European Union military structures, as well as the continuation of the transformation of the Slovenian Armed Forces. The time after 2011 and its characteristics have not been defined yet; however, it has undoubtedly been marked by the financial crisis, which has resulted in the reduction of funding for defence in most member states of the Alliance and the European Union. The Alliance has placed great importance on smart defence, niche capabilities and other activities, endorsed at the NATO Summits in Chicago in 2012, in Wales in 2014 and in Warsaw in 2016. Several authors whose contributions have been published in the Contemporary Military Challenges have addressed topical issues after 2011, and thus contributed to the development of military defence contents. The same guidelines are followed in the current issue as well. In his article entitled The challenge to defense reform in Central/Eastern Europe, with reference to Slovenia, Thomas Durell Young shares his outside (i.e. American) view of defence reforms and Slovenia as part of the international environment. Has Slovenia developed modern armed forces during the past twenty-five years, and can it contribute successfully to joint capabilities in the international environment; or is there still much more to be done when it comes to defence? The reduction in defence resources has brought about changes in the countries which are member states of the EU and the Alliance. In her article entitled New Modern Threat to National Security – Budget Threat, Vida Žurga stresses the importance of self-sufficiency of Slovenia’s national security system, and how that self-sufficiency has been tested in the case of the migrant crisis. Viktor Potočnik continues his trilogy. For this issue, he prepared the article Fourth Generation Warfare (Part 2): Comprehensive Reform of the National Security System. As he mentions, some authors have recently proposed several suggestions and expressed concerns regarding Slovenia’s current national security system and the necessary changes, but nothing concrete has changed. Potočnik goes into more detail, which he presents with great clarity. The meaning of strategic communications has been the topic of many authors. But how are strategic communications organised within NATO? The question is answered by Nina Raduha in her article Nato's Strategic Communications Concept in the Republic of Slovenia with emphasis on the Slovenian Armed Forces. It is not merely a matter for the Slovenian Armed Forces, but the state as a whole, and should be an important part of its strategic communications. But is that really the case? Igor Prelog believes that combat aviation can be especially suitable for air support to counter-insurgency operations due to its many advantages over high-technology jet-engine combat aircraft. He discusses how Slovenia could help with counter- insurgency operations within the Alliance in his article Military aviation in counter- insurgency operations and analysis of the use of Pilatus PC-9. Gregor Jazbec is the author of the article Psychology of combat: research on a soldier's experiencing of war and psychological consequences of combat. It is a demanding topic which deals with extreme aspects of combat. The author conducted research on experience of war and psychological consequences among soldiers participating in different wars in Slovenia, and compared his findings with similar research carried out in other states. We hope you enjoy reading this issue and feel inspired to write an article yourself.

Abstract:

On behalf of Central Texas Regional Water Supply Corporation (CTRWSC) and VRRSP Consultants, LLC, SWCA Environmental Consultants (SWCA) conducted archaeological data recovery excavations at multicomponent site 41GU177 (the Snakeskin Bluff Site) within the proposed alignment of the Vista Ridge Regional Water Supply Project (Vista Ridge) in Guadalupe County, Texas. Investigations were conducted in compliance with Section 106 of the National Historic Preservation Act (NHPA) (54 United States Code [USC] 306108) and its implementing regulations (36 Code of Federal Regulations [CFR] 800), in anticipation of a Nationwide Permit 12 from the U.S. Army Corps of Engineers (USACE) in accordance with Section 404 of the Clean Water Act. In addition, the work is subject to compliance with the Antiquities Code of Texas (ACT), as the Vista Ridge Project will be ultimately owned by CTRWSC, a political subdivision of the State of Texas. The Vista Ridge project will involve construction of an approximately 140-mile-long, 60-inch-diameter water pipeline from north-central San Antonio, Bexar County, to Deanville, Burleson County, Texas. The of area of potential effects (APE) for the Phase I survey efforts included the proposed centerline alignment and a 100-foot-wide corridor (50 feet on either side of centerline), as well as temporary and permanent construction easem*nts, and aboveground facilities, such as pump stations and the northern and southern termini sites. Between June 2015 and March 2018 the cultural resources inventory identified 78 cultural resources (i.e., 64 archaeological sites and 14 isolated finds). Included in that inventory was site 41GU177, originally discovered on August 31, 2015 on the west bank of the Guadalupe River. Site 41GU177 is a stratified prehistoric site on the western high bank of the Guadalupe River southeast of New Braunfels, Texas near the community of McQueeney. The site contains components deposited intermittently from approximately the Late Archaic to Transitional Archaic periods through Late Prehistoric times. The primary components investigated in the excavations span the final Late Archaic period and into the Austin phase of the Late Prehistoric, a timeframe from approximately 2,600 to 900 years ago. The field investigations, conducted between October 2016 and December 2017, included intensive shovel testing, geomorphological study with mechanical excavations, and subsequent hand excavations. This report presents the results of the data recovery investigations conducted from November–December 2017. The survey results and testing results have been previously reported on (Acuña et al. 2016; Rodriguez et al. 2017); the testing results are also presented in Appendix A. SWCA’s work at 41GU177 was conducted under the ACT. The state regulations mandate the evaluation of the site’s eligibility for designation as a State Antiquities Landmark (SAL) or for listing on the National Register of Historic Places (NRHP). The survey and testing investigations were conducted under ACT Permit No. 7295, and the subsequent data recovery was completed under Permit No. 8231. Brandon S.Young served as initial Principal Investigator (PI) on both permits and Christina Nielsen took over asPI on the permits for the final reporting stages of the project. Overall, 34.1 m3 of sediment was excavated from the site during the data recovery through both traditional and feature-focused unit excavations. During these excavations, approximately 22 m2 of Late Prehistoric components were exposed, consisting of rock-lined hearths and 6,496 artifacts. The Late Prehistoric artifacts included Edwards points, Perdiz points, a Fresno point, ceramics, bifaces, an end scraper, a shell bead, various informal lithic tools, ground stone, choppers, debitage, and faunal remains. The Late Prehistoric component was approximately 40–80 cm thick. No cultural features were identified within the underlying Archaic components of the site; however, 3,421 artifacts were recovered including a Zephyr point, bifaces, ground stone, various informal lithic tools, choppers, debitage, and faunal remains. The Transitional Archaic component was approximately 35–60 cm thick; however, the underlying Archaic (and possible older) components were not defined. The excavations were limited to the right-of-way, and consequently the exposure afforded only a partial glimpse of the overall site. Based on the assemblage, the site is interpreted as a logistical base camp as indicated by both formal and informal tool forms and site furniture. Small groups exploited the abundance of lithic raw material and riparian zone resources, making forays into the landscape to hunt and forage. A total of four radiocarbon dates from the Late Prehistoric components reveal several short-term encampments over the course of several centuries from approximately 600 to 1200 B.P. (A.D. 750 to 1350). The Toyah Phase component has some noted disturbances (especially towards the ground surface), but good integrity from where the radiocarbon sample was collected. The Austin Phase component is vertically and horizontally discrete, contains a substantial amount of archaeological materials, and the site structure and radiocarbon dates suggests multiple, discrete occupations. The data recovery investigations at the Snakeskin Bluff site sought to address environmental, technological, chronological, and adaptive changes during the transition from Archaic to Late Prehistoric. As mentioned, the overall artifact and feature recovery at the site was low and disturbances and mixing of components was noted, especially within the upper deposits of the site. Disturbances within the Late Prehistoric Toyah Phase were most prevalent in the eastern portions of the site. The Late Prehistoric Austin Phase component contained intact, well-preserved archaeological deposits containing preserved flora and faunal material, cooking features, and diagnostic implements. The Transitional Archaic (and older) occupations were difficult to characterize, due to limited quantities of temporal diagnostic artifacts, lack of cultural features, and low artifact recovery. Despite these limitations, the data recovered from the cultural components show diachronic shifts between the technological and foraging strategies of the Archaic and Late Prehistoric. In concurrence with the 2016–2017 testing recommendations, the Snakeskin Bluff site is considered eligible for designation as an SAL and for the NRHP. Although not all cultural components of the site were stratigraphically discrete, the Late Prehistoric Austin Phase component revealed intact, well-preserved archaeological deposits that significantly contributed to our understanding of Late Prehistoric patterns. Given the sensitive nature of the cultural deposits at 41GU177, the main concern following the completion of data recovery excavations was the prevention of significant surface and subsurface impacts to the site during clearing and pipeline construction. As such, SWCA developed a site monitoring protocol; methods and results of the monitoring efforts are provided in Appendix H. Contributing components beyond the impact area will not be affected and will be preserved by avoidance; however, it is important to note that these investigations mitigated the project-specific effects, not the entire site. Any future project that could impact the site’s deeper deposits, or those beyond the current right-of-way, warrant further consideration to assess the possibilities for additional contributing components. With these considerations, no further work is recommended.

Abstract:

Material samples form an important portion of the data infrastructure for many disciplines. Here, a material sample is a physical object, representative of some physical thing, on which observations can be made. Material samples may be collected for one project initially, but can also be valuable resources for other studies in other disciplines. Collecting and curating material samples can be a costly process. Integrating institutionally managed sample collections, along with those sitting in individual offices or labs, is necessary to faciliate large-scale evidence-based scientific research. Many have recognized the problems and are working to make data related to material samples FAIR: findable, accessible, interoperable, and reusable. The Internet of Samples (i.e., iSamples) is one of these projects. iSamples was funded by the United States National Science Foundation in 2020 with the following aims: enable previously impossible connections between diverse and disparate sample-based observations; support existing research programs and facilities that collect and manage diverse sample types; facilitate new interdisciplinary collaborations; and provide an efficient solution for FAIR samples, avoiding duplicate efforts in different domains (Davies et al. 2021) enable previously impossible connections between diverse and disparate sample-based observations; support existing research programs and facilities that collect and manage diverse sample types; facilitate new interdisciplinary collaborations; and provide an efficient solution for FAIR samples, avoiding duplicate efforts in different domains (Davies et al. 2021) The initial sample collections that will make up the internet of samples include those from the System for Earth Sample Registration (SESAR), Open Context, the Genomic Observatories Meta-Database (GEOME), and Smithsonian Institution Museum of Natural History (NMNH), representing the disciplines of geoscience, archaeology/anthropology, and biology. To achieve these aims, the proposed iSamples infrastructure (Fig. 1) has two key components: iSamples in a Box (iSB) and iSamples Central (iSC). The iSC component will be a permanent Internet service that preserves, indexes, and provides access to sample metadata aggregated from iSBs. It will also ensure that persistent identifiers and sample descriptions assigned and used by individual iSBs are synchronized with the records in iSC and with identifier authorities like International Geo Sample Number (IGSN) or Archival Resource Key (ARK). The iSBs create and maintain identifiers and metadata for their respective collection of samples. While providing access to the samples held locally, an iSB also allows iSC to harvest its metadata records. The metadata modeling strategy adopted by the iSamples project is a metadata profile-based approach, where core metadata fields that are applicable to all samples, form the core metadata schema for iSamples. Each individual participating collectionis free to include additional metadata in their records, which will also be harvested by iSC and are discoverable through the iSC user interface or APIs (Application Programming Interfaces), just like the core. In-depth analysis of metadata profiles used by participating collections, including Darwin Core, has resulted in an iSamples core schema currently being tested and refined through use. See the current version of the iSamples core schema. A number of properties require a controlled vocabulary. Controlled vocabularies used by existing records are kept, while new vocabularies are also being developed to support high-level grouping with consistent semantics across collection types. Examples include vocabularies for Context Category, Material Category, and Specimen Type (Table 1). These vocabularies were also developed in a bottom-up manner, based on the terms used in the existing collections. For each vocabulary, a decision tree graph was created to illustrate relations among the terms, and a card sorting exercise was conducted within the project team to collect feedback. Domain experts are invited to take part in this exercise here, here, and here. These terms will be used as upper-level terms to the existing category terms used in the participating collections and hence create connections among individual participating collections. iSample project members are also active in the TDWG Material Sample Task Group and the global consultation on Digital Extended Specimens. Many members of the iSamples project also lead or participate in a sister research coordination network (RCN), Sampling Nature. The goal of this RCN is to develop and refine metadata standards and controlled vocabularies for the iSamples and other projects focusing on material samples. We cordially invite you to participate in the Sampling Nature RCN and help shape the future standards for material samples. Contact Sarah Ramdeen (sramdeen@ideo.columbia.edu) to engage with the RCN.

Abstract:

It is now almost 15 years since the world witnessed one of modern history’s most devastating terrorist attacks on the United States on 11 September 2001. Despite all its promises, the so called ‘War on Terror’ failed to combat a growing tide of violent extremism. 11 years after the US led offensive on Iraq in 2003, the rise of terrorism by non-state actors in the Arab world presents a significant concern to international security and world peace. Since 2001 Australian Muslims have consistently been called upon to openly reject terrorism committed by a minority of Muslims who adhere to an extreme interpretation of Islamic doctrine that justifies attacks on civilians both in the Arab world and abroad.The responsibility placed on Australian Muslims to actively reject terrorism comes from both official channels through government funded programs under the banner of counter terrorism and countering violent extremism and the public through the popular media. Yet, Muslims in Australia who do speak out against religiously motivated non-state terrorism find themselves in an impossible bind. They are expected to speak out as representatives of a fragmented, heterogeneous and diverse mix of communities and ideologies. Often, when they do speak out, they are viewed with suspicion and presumed to be ‘apologists for Islam’ whose claim to tolerance and the peaceful nature of Islamic doctrine purposefully ignores its true nature. Such responses render these spokespersons illegitimate- both as representatives of Muslim communities and as Australian citizens. The question “Why don’t moderate Muslims speak out against terrorism?” is often raised in the popular media in response to attacks against Western interests by jihadi groups. On 15 August 2014 an article in the Daily Telegraph by well-known conservative journalist Piers Akerman raised the question in relation to the Australian government’s announcement of increased powers for law enforcement agencies to deal with the issue of returned foreign fighters who had joined the Islamic State’s conflict in Iraq and Syria. The article, titled “It’s Time for Muslim Leaders to Speak Up” reiterated much of the construction of the silent Muslim majority that has pervaded the Australian popular media since 2001. Akerman states: “They [the Australian government] should be making it clear to Australian Muslims that they expect their leaders to speak out more vehemently against those who groom terrorists from the among the young and stupidly impressionable in their communities”. While he continues by acknowledging that Muslims in Australia are diverse in ethnicity and religious views and that the vast majority of Muslims do not support terrorism, he concludes by stating that “the few are costing the majority of Australians millions in security and those who enjoy leadership titles must accept that some responsibility attaches to their position or they should abdicate in favour of individuals who are prepared to consent to the obligations inherent in their station” (Piers Akerman). The same sentiments were expressed by Pia Ackerman in the Australian who wrote that “AUSTRALIA’S Muslim leaders need to speak out against Islamic State terrorists or risk losing their credibility and ability to reach young men attracted to the extremists’ cause” (Pia Akerman).Other responses in the popular media present a different argument. In an article titled “The Moderate Muslims Are Talking If Only You Will Listen”, David Penberthy of the Herald Sun cites examples of Muslim Australians who are speaking out including the case of prominent Sydney GP Jamal Rifi whose condemnation of terrorist activities in the Arab world has earned him death threats from members of the Islamic State (Penberthy). Yet, as Penberthy rightly acknowledges the questions “where are the moderates? Where are the decent Muslims? Are there any? Why aren’t they speaking out?” are still the most salient questions being asked of Muslims in the public sphere. For Australian Muslims at least, they are questions that pervade their everyday lives. It is these questions for example that leads Muslim women who wear the tradition head covering or hijab to challenge media representations of themselves as complicit actors in terrorism by acting as alternative sources of truth for curious co-workers and members of the broader community (see Aly, A Study).Muslim women who do not wear the hijab can face even more barriers to speaking out because they do not pass the test of ‘legitimate’ Muslims: those who fit the stereotype of the angry bearded male and the oppressed female shrouded in black. This author, who has in the past written about extremist interpretations of Islam, has faced condemnation from anti- Islamic groups who questioned her authenticity as a Muslim. By speaking out as a Muslim against the violent actions of some Muslims in other parts of the world, I was being accused of misinformed. Ironically, those who are vehemently anti- Islamic espouse the very same ideological world view and interpretations of Islamic doctrine as those Muslims they claim to oppose. Both groups rely on an extreme and minority version of Islam that de-legitimises more mainstream, nuanced interpretations and both groups claim legitimacy to the truth that Islam can only ever be violent, aggressive and oppositional.It is not just in the public and media discourses that Muslims who speak out against terrorism face being branded illegitimate. The policy response to home-grown terrorism — acts of violence carried out by Australian citizens within Australia — has, albeit inadvertently, created the conditions through which Muslims must verify their legitimate claims to being Australian by participating in the governments’ program of counter terrorism.In the wake of the 2005 London bombings, the Prime Minister met with selected representatives from Muslim communities to discuss the development of a Muslim Community Reference Group. The Group was charged with assisting the Australian Government by acting as an advisory group and by working with Muslim communities “promote harmony, mutual understanding and Australian values and to challenge violence, ignorance and rigid thinking”. This was iterated through a Statement of Principles that committed members of Muslim communities to pursue “moderate’ Islam (Prime Minister, “Meeting”). The very need for a Muslim summit and for the development of a Statement of Principles (later endorsed by the Council of Australian Governments, COAG), sends a lucid message to the Australian public that not only are Australian Muslims responsible for terrorism but that they also have the capacity to prevent or minimise the threat of an attack in Australia.In 2005, the policy response to terrorism took its first step towards linking the social harmony agenda to the securitisation of the state in the form of the National Action Plan to Build Social Cohesion, Harmony and Security. The stated purpose of the National Action Plan (NAP) notably conflated national security with social cohesion and harmony and clearly indicated an understanding that violent extremism could be addressed through programs designed to reinforce Australian values, social harmony, interfaith understanding and tolerance: “The purpose of this National Action Plan (NAP) is to reinforce social cohesion, harmony and support the national security imperative in Australia by addressing extremism, the promotion of violence and intolerance…”(Commonwealth of Australia, National Action Plan).Between 2005 and 2010, the National Action Plan provided funding for 83 community based projects deemed to meet the Plan’s criteria of addressing extremism and the promotion of violence. Of the 83 projects funded, 33 were undertaken by associations that identified as Muslim or Islamic (some applicants received funding for more than one project or in more than one round). The remaining 50 organisations funded included universities and vocational training organisations (4), multicultural social services or migrant resource centres (14), interfaith groups (3), local councils (4), ethnic organisations (specifically African, East African, Afghan, Hazara, Arabic and Pakistani), sporting clubs (4) and miscellaneous social clubs and service providers. The kinds of projects that were funded were predominantly aimed at Muslim communities, most notably youth and women, and the provision of services, programs, education, information and dialogue. Sixty five of the projects funded were explicitly aimed at Muslim communities and identified their target groups variously as: ‘African Muslim’; ‘Muslim youth’; ‘Muslim women’; ‘at risk Muslims’; ‘young Muslims’; ‘Iraqi Muslims’; ‘Lebanese Muslims’ and ‘young Muslim men from Arabic speaking backgrounds’. Seven projects were described as involving ‘interfaith’ elements, though a further 13 projects described some form of interaction between Muslim and non-Muslim communities and groups through activities such as sport, dialogue, fashion parades, workshops, art and craft programs, music workshops. 29 projects involved some form of leadership training for Muslims: youth, women and young men. Overall, the range of projects funded under the National Action Plan in the five years of its operation reflect a policy approach that specifically identifies Muslim communities (including ethno specific and new and emerging Muslim communities) as the primary target of Australia’s broader security strategy.The National Action Plan was succeeded by the Building Community Resilience (BCR) Program. Despite the positive steps taken in attempting to move the BCR program away from the social harmony policy agenda, it continued to reflect an underlying preoccupation with the assumptions of its predecessor. Between 2011- 2013 it funded 51 community based projects. Of these, 7 projects were undertaken by Islamic or Muslim associations. Ten of the projects specifically target Muslims or Muslim communities, with 6 of these being Muslim youth leadership and/or mentoring programs. The remaining 4 Muslim focussed projects include a project designed to encourage Muslim youth to build positive connections with the broader community, the development of a Common Curriculum Framework for teaching Islamic Studies in Australian Islamic primary and secondary schools, a project to address misconceptions about Islam and promote cultural understanding and the production of a DVD for schools to address misperceptions about Muslims. Notably, only one project specifically targets white supremacist violent extremism. The Australian governments’ progressive policy approach to countering violent extremism at home has disproportionately focussed on the Australian Muslim communities. In an environment where Muslims are viewed with suspicion and as having the primary responsibility as both perpetrators and gatekeepers of terroristic ideologies, Muslims in diaspora communities have been forced to make legitimate claims to their innocence. In order to do this they are required to reaffirm their commitment to Australian values, not just by speaking out against terrorism but also by participating in programs that are based on false assumptions about the nature of Muslim citizenship in Australia and the premise that Muslim Australians are, both individually and collectively, opposed to such values by virtue of their religious affiliation. In 2014 and in response to growing concerns about the number of Australians travelling to Iraq and Syria to fight alongside the Islamic State, the government made a bold move by declaring its intention to overhaul existing terror laws. The new laws would reverse the onus of proof on those who travelled to certain countries deemed to be terrorist hotspots to prove that they were not partaking in armed conflict or terrorist training. They would also give more powers to law enforcement and surveillance agencies by lowering the threshold of arrest without a warrant. The announcement of the new laws by the Prime Minister coincided with the news that the Government would abandon its controversial plans to drop section 18c from the Racial Discrimination Act which makes it unlawful to "offend, insult, humiliate or intimidate another person or a group of people" because of their race or ethnicity" (Aston). The announcement was made under the guise of a press conference on terror laws and inferred that the back down on the Racial Discrimination Act reforms were a measure to win over the Muslim communities cooperation on the new terror laws. Referring to a somewhat curious notion of “team Australia”, the Prime Minister stated “I want to work with the communities of our country as team Australia here” (Aston). “Team Australia” has since become the Government’s narrative frame for garnering public support for its proposed new terrorism laws. Echoing his predecessor John Howard, whose narrative of Australian values pervaded much of the political discourse during his term in office, Prime Minister Abbott stated in a radio interview that "everyone has got to put this country, its interests, its values and its people first, and you don't migrate to this country unless you want to join our team". He followed this statement by emphasising that "What we need to do is to encourage the moderate mainstream to speak out" (Cox).Shortly after the release of a horrific image on social media showing Australian jihadists proudly flaunting the severed heads of their victims, the Australian government reacted with an even bolder move to introduce legislation that would see the government cancelling the welfare payments of persons “identified by national security agencies as being involved in extremist conduct.” According to the Government the reforms would “enable the Department of Human Services to cancel a person’s welfare payment if it receives advice that a person has been assessed as a serious threat to Australia’s national security.”(Prime Minister of Australia) The move was criticised by several groups including academics who argued that it would not only alienate the already disenfranchised Muslim communities, but could also result in greater radicalisation (Ireland). In response to the raft of new measures perceived to be targeting Muslim communities, Australian Muslims took measured steps to voice their opposition through written statements and media releases stating that, among other things: These proposals come in the same style as those which have preceded [sic] since the Howard era. An alleged threat is blown out of all proportion as the pretext, further "tightening" of the laws is claimed necessary and rushed through, without proper national debate or community consultation. The reality of the alleged threat is also exposed by the lack of correspondence between the official 'terror threat' level, which has remained the same since 2001, and the hysterical rhetoric from government ministers. (ABC News, "Australian Muslims")Australian Muslim leaders also boycotted government meetings including a planned meeting with the Prime Minister to discuss the new laws. The Prime Minister promptly branded the boycott “foolish” (ABC News, "Tony Abbott") yet refused to acknowledge the legitimacy of the claims made in the media statements and messages by Muslim organisations that prompted the boycotts. As Australian Muslims continue to grapple with ways to legitimize their claims to citizenship, the developing discourse on national security and terrorism continues to define them as the objects of terror. Notably, the media discourse is showing some signs of accommodating the views of Muslim Australians who have found some space in the public sphere. Recent media reporting on terror activities in the Middle East has given some consideration to the voices of Muslim leaders who openly oppose violent extremism. Yet Muslims in Australia are still battling for legitimacy. Those who speak out against the hijacking of their religion by a minority who espouse a rigid and uncompromising ideology in order to justify violence often find themselves the subjects of intense scrutiny. From within their communities they are seen to be mouth pieces for an unfair and unjust government agenda that targets Muslims as objects of fear. From outside their communities they are seen to be apologists for Islam whose authenticity should be questioned if not denied. Attempts by Muslim Australians to have their voices heard through political practices that define the very nature of democracy including peaceful demonstrations, boycotts and written statements have not been taken seriously. As a result, Muslim voices in Australia are deemed illegitimate regardless of the forms or platforms through which they seek to be heard. ReferencesABC News. “Australian Muslims Denounce Proposed 'Anti-Terror' Laws”. ABC Religion and Ethics, 21 Aug. 2014. 23 Aug. 2014 .ABC News. “Tony Abbott Says Muslim Leaders 'Foolishly Boycotted' Counterterrorism Law Meeting.” 22 Aug. 2014. 24 Aug. 2014 .Akerman, Pia. “Muslim Leaders Must Speak Out against Extremists, Academic Warns.” The Australian 13 Aug. 13 2014. 20 Aug. 2014 . Akerman, Piers. “It's Time for Muslim Leaders to Speak Up.” Daily Telegraph 15 Aug. 2014. 20 Aug. 2014 .Alynne, A. A Study of Audience Responses to the Media Discourse about the ‘Other’: The Fear of Terrorism between Australian Muslims and the Broader Community. Lampeter: Edwin Mellen, 2010.Aly, Anne. “Media Hegemony, Activism and Identity: Muslim Women Re-Presenting Muslim Women.” Beyond the Hijab Debates: New Conversations on Gender, Race and Religion, eds. T. Dreher and C. Ho. Cambridge: Cambridge Scholars, 2009.Aly, Anne, and Mark Balnaves. “The Atmosfear of Terror: Affective Modulation and the War on Terror.” M/C Journal 8.6 (2005).Aly, Anne, and Lelia Green. “‘Moderate Islam’: Defining the Good Citizen.” M/C Journal 10.6/11.1 (2008). 13 April 2008 ‹http://journal.media-culture.org.au/0804/08aly-green.php›.Aston, H. “Tony Abbott Dumps Controversial Changes to 18C Racial Discrimination Laws.” Sydney Morning Herald 5 Aug. 2014. 24 Aug. 2014 .Australian Government, Attorney General's Department. Building Community Resilience Grants Program. n.d. 24 July 2014 . Commonwealth of Australia. Transnational Terrorism White Paper: The Threat to Australia. Canberra: Department of Prime Minister and Cabinet, 2004. . Commonwealth of Australia. National Action Plan to Build Social Cohesion, Harmony and Security. Canberra: Department of Immigration and Citizenship, 2006. .Commonwealth of Australia. Counter Terrorism White Paper: Securing Australia, Protecting our Community. Canberra: Department of Prime Minister and Cabinet, 2010. 19 Nov. 2011 .Cox, L. “'You Don't Migrate to This Country unless You Want to Join Our Team': Tony Abbott Renews Push on National Security Laws.” Sydney Morning Herald 18 Aug. 2014. 24 Aug. 2014 . Ireland, J. “Extremism Warning on Coalition's Move to Cut Welfare Payments.” Sydney Morning Herald 19 Aug. 2014. 24 Aug. 2014 .Penberthy, D. “The Moderate Muslims Are Talking If Only You Will Listen. Herald Sun 17 Aug. 2014 .Prime Minister of Australia. “New Counter-Terrorism Measures for a Safer Australia - Cancelling Welfare Payments to Extremists”. 16 Aug. 2014. 23 Aug. 2014 .Prime Minister of Australia. “Meeting with Islamic Community Leaders, Statement of Principles.” 23 Aug. 2005. July 2008 .

Abstract:

Introduction The scientific validity of climate change claims, how to intervene (if at all) in environmental, economic, political and social consequences of climate change, and the adaptation and mitigation needed with any given climate change scenario, are contested areas of public, policy and academic discourses. For marginalised populations, the climate discourses around adaptation, mitigation, vulnerability and resilience are of particular importance. This paper considers the silence around disabled people in these discourses. Marci Roth of the Spinal Cord Injury Association testified before Congress in regards to the Katrina disaster: [On August 29] Susan Daniels called me to enlist my help because her sister in-law, a quadriplegic woman in New Orleans, had been unsuccessfully trying to evacuate to the Superdome for two days. […] It was clear that this woman, Benilda Caixetta, was not being evacuated. I stayed on the phone with Benilda, for the most part of the day. […] She kept telling me she’d been calling for a ride to the Superdome since Saturday; but, despite promises, no one came. The very same paratransit system that people can’t rely on in good weather is what was being relied on in the evacuation. […] I was on the phone with Benilda when she told me, with panic in her voice “the water is rushing in.” And then her phone went dead. We learned five days later that she had been found in her apartment dead, floating next to her wheelchair. […] Benilda did not have to drown. (National Council on Disability, emphasis added) According to the Intergovernmental Panel on Climate Change (IPCC), adaptation is the “Adjustment in natural or human systems in response to actual or expected climatic stimuli or their effects, which moderates harm or exploits beneficial opportunities” (IPCC, Climate Change 2007). Adaptations can be anticipatory or reactive, and depending on their degree of spontaneity they can be autonomous or planned (IPCC, Fourth Assessment Report). Adaptations can be private or public (IPCC, Fourth Assessment Report), technological, behavioural, managerial and structural (National Research Council of Canada). Adaptation, in the context of human dimensions of global change, usually refers to a process, action or outcome in a system (household, community, group, sector, region, country) in order for that system to better cope with, manage or adjust to some changing condition, stress, hazard, risk or opportunity (Smit and Wandel). Adaptation can encompass national or regional strategies as well as practical steps taken at the community level or by individuals. According to Smit et al, a framework for systematically defining adaptations is based on three questions: (i) adaptation to what; (ii) who or what adapts; and (iii) how does adaptation occur? These are essential questions that have to be looked at from many angles including cultural and anthropological lenses as well as lenses of marginalised and highly vulnerable populations. Mitigation (to reduce or prevent changes in the climate system), vulnerability (the degree to which a system is susceptible to, and unable to cope with, the adverse effects of climate change), and resilience (the amount of change a system can undergo without changing state), are other important concepts within the climate change discourse. Non-climate stresses can increase vulnerability to climate change by reducing resilience and can also reduce adaptive capacity because of resource deployment to competing needs. Extending this to the context of disabled people, ableism (sentiment to expect certain abilities within humans) (Wolbring, “Is there an end to out-able?”) and disablism (the unwillingness to accommodate different needs) (Miller, Parker and Gillinson) are two concepts that will thus play themselves out in climate discourses. The “Summary for Policymakers” of the IPCC 2007 report, Climate Change 2007: Impacts, Adaptation and Vulnerability, states: “Poor communities can be especially vulnerable, in particular those concentrated in high-risk areas. They tend to have more limited adaptive capacities, and are more dependent on climate-sensitive resources such as local water and food supplies.” From this quote one can conclude that disabled people are particularly impacted, as the majority of disabled people live in poverty (Elwan). For instance, CARE International, a humanitarian organisation fighting global poverty, the UN Office for the Coordination of Humanitarian Affairs, and Maplecroft, a company that specialises in the calculation, analysis and visualisation of global risks, conclude: “The degree of vulnerability is determined by underlying natural, human, social, physical and financial factors and is a major reason why poor people—especially those in marginalised social groups like women, children, the elderly and people with disabilities—are most affected by disasters” (CARE International). The purpose of this paper is to expose the reader to (a) how disabled people are situated in the culture of the climate, adaptation, mitigation and resilience discourse; (b) how one would answer the three questions, (i) adaptation to what, (ii) who or what adapts, and (iii) how does adaptation occur (Smit et al), using a disabled people lens; and (c) what that reality of the involvement of disabled people within the climate change discourse might herald for other groups in the future. The paper contends that there is a pressing need for the climate discourse to be more inclusive and to develop a new social contract to modify existing dynamics of ableism and disablism so as to avoid the uneven distribution of evident burdens already linked to climate change. A Culture of Neglect: The Situation of Disabled People As climates changes, environmental events that are classified as natural disasters are expected to be more frequent. In the face of recent disaster responses, how effective have these efforts been as they relate to the needs and challenges faced by disabled people? Almost immediately after Hurricane Katrina devastated the Gulf Coast, the National Council on Disability (NCD) in the United States estimated that 155,000 people with disabilities lived in the three cities hardest hit by the hurricane (about 25 per cent of the cities’ populations). The NCD urged emergency managers and government officials to recognise that the need for basic necessities by hurricane survivors with disabilities was “compounded by chronic health conditions and functional impairments … [which include] people who are blind, people who are deaf, people who use wheelchairs, canes, walkers, crutches, people with service animals, and people with mental health needs.” The NCD estimated that a disproportionate number of fatalities were people with disabilities. They cited one statistic from the American Association of Retired Persons (AARP): “73 per cent of Hurricane Katrina-related deaths in New Orleans area were among persons age 60 and over, although they comprised only 15 per cent of the population in New Orleans.” As the NCD stated, “most of those individuals had medical conditions and functional or sensory disabilities that made them more vulnerable. Many more people with disabilities under the age of 60 died or were otherwise impacted by the hurricanes.” As these numbers are very likely linked to the impaired status of the elderly, it seems reasonable to assume similar numbers for non-elderly disabled people. Hurricane Katrina is but one example of how disabled people are neglected in a disaster (Hemingway and Priestley; Fjord and Manderson). Disabled people were also disproportionately impacted in other disasters, such as the 1995 Great Hanshin Earthquake in Japan (Nakamura) or the 2003 heatwave in France, where 63 per cent of heat-related deaths occurred in institutions, with a quarter of these in nursing homes (Holstein et al.). A review of 18 US heatwave response plans revealed that although people with mental or chronic illnesses and the homeless constitute a significant proportion of the victims in recent heatwaves, only one plan emphasised outreach to disabled persons, and only two addressed the shelter and water needs of the homeless (Ebi and Meehl; Bernhard and McGeehin). Presence of Disabled People in Climate Discourse Although climate change will disproportionately impact disabled people, despite the less than stellar record of disaster adaptation and mitigation efforts towards disabled people, and despite the fact that other social groups (such as women, children, ‘the poor’, indigenous people, farmers and displaced people) are mentioned in climate-related reports such as the IPCC reports and the Human Development Report 2007/2008, the same reports do not mention disabled people. Even worse, the majority of the material generated by, and physically set up for, discourses on climate, is inaccessible for many disabled people (Australian Human Rights Commission). For instance, the IPCC report, Climate Change 2007: Impacts, Adaptation and Vulnerability, contains Box 8.2: Gender and natural disasters, makes the following points: (a) “men and women are affected differently in all phases of a disaster, from exposure to risk and risk perception; to preparedness behaviour, warning communication and response; physical, psychological, social and economic impacts; emergency response; and ultimately to recovery and reconstruction”; (b) “natural disasters have been shown to result in increased domestic violence against, and post-traumatic stress disorders in, women”; and (c) “women make an important contribution to disaster reduction, often informally through participating in disaster management and acting as agents of social change. Their resilience and their networks are critical in household and community recovery.” The content of Box 8.2 acknowledges the existence of different perspectives and contributions to the climate discourse, and that it is beneficial to explore these differences. It seems reasonable to assume that differences in perspectives, contributions and impact may well also exist between people with and without disabilities, and that it may be likewise beneficial to explore these differences. Disabled people are differently affected in all phases of a disaster, from exposure to risk and risk perception; to preparedness behaviour, warning communication and response; physical, psychological, social and economic impacts; emergency response; and ultimately to recovery and reconstruction. Disabled people could also make an important contribution to disaster reduction, often informally through participating in disaster management and acting as agents of social change. Their resilience and their networks are critical in household and community recovery, important as distributors of relief efforts and in reconstruction design. The Bonn Declaration from the 2007 international conference, Disasters are always Inclusive: Persons with Disabilities in Humanitarian Emergency Situations, highlighted many problems disabled people are facing and gives recommendations for inclusive disaster preparedness planning, for inclusive response in acute emergency situations and immediate rehabilitation measures, and for inclusive post-disaster reconstruction and development measures. Many workshops were initiated by disabled people groups, such as Rehabilitation International. However, the disabled people disaster adaptation and mitigation discourse is not mainstreamed. Advocacy by people with disability for accessible transport and universal or “life-cycle” housing (among other things) shows how they can contribute significantly to more effective social systems and public facilities. These benefit everyone and help to shift public expectations towards accessible and flexible amenities and services—for example, emergency response and evacuation procedures are much easier for all if such facilities are universally accessible. Most suggestions by disabled people for a more integrative, accessible physical environment and societal attitude benefit everyone, and gain special importance with the ever-increasing proportion of elderly people in society. The IPCC Fourth Assessment Report is intended to be a balanced assessment of current knowledge on climate change mitigation. However, none of the 2007 IPCC reports mention disabled people. Does that mean that disabled people are not impacted by, or impact, climate change? Does no knowledge of adaptation, mitigation and adaptation capacity from a disabled people lens exist, or does the knowledge not reach the IPCC, or does the IPCC judge this knowledge as irrelevant? This culture of neglect and unbalanced assessment of knowledge evident in the IPCC reports was recognised before for rise of a ‘global’ climate discourse. For instance, a 2001 Canadian government document asked that research agendas be developed with the involvement of, among others, disabled people (Health Canada). The 2009 Nairobi Declaration on Africa’s response to climate change (paragraph 36) also asks for the involvement of disabled people (African Ministerial Conference on the Environment). However, so far nothing has trickled up to the international bodies, like the IPCC, or leading conferences such as the United Nations Climate Change Conference Copenhagen 2009. Where Will It End? In his essay, “We do not need climate change apartheid in adaptation”, in the Human Development Report 2007/2008, Archbishop Desmond Tutu suggests that we are drifting into a situation of global adaptation apartheid—that adaptation becomes a euphemism for social injustice on a global scale (United Nations Development Programme). He uses the term “adaptation apartheid” to highlight the inequality of support for adaptation capacity between high and low income countries: “Inequality in capacity to adapt to climate change is emerging as a potential driver of wider disparities in wealth, security and opportunities for human development”. I submit that “adaptation apartheid” also exists in regard to disabled people, with the invisibility of disabled people in the climate discourse being just one facet. The unwillingness to accommodate, to help the “other,” is nothing new for disabled people. The ableism that favours species-typical bodily functioning (Wolbring, “Is there an end to out-able?”; Wolbring, “Why NBIC?”) and disablism (Miller, Parker, and Gillinson)—the lack of accommodation enthusiasm for the needs of people with ‘below’ species-typical body abilities and the unwillingness to adapt to the needs of “others”—is a form of “adaptation apartheid,” of accommodation apartheid, of adaptation disablism that has been battled by disabled people for a long time. In a 2009 online survey of 2000 British people, 38 per cent believed that most people in British society see disabled people as a “drain on resources” (Scope). A majority of human geneticist concluded in a survey in 1999 that disabled people will never be given the support they need (Nippert and Wolff). Adaptation disablism is visible in the literature and studies around other disasters. The 1988 British Medical Association discussion document, Selection of casualties for treatment after nuclear attack, stated “casualties whose injuries were likely to lead to a permanent disability would receive lower priority than those expected to fully recover” (Sunday Morning Herald). Famine is seen to lead to increased infanticide, increased competitiveness and decreased collaboration (Participants of the Nuclear Winter: The Anthropology of Human Survival Session). Ableism and disablism notions experienced by disabled people can now be extended to include those challenges expected to arise from the need to adapt to climate change. It is reasonable to expect that ableism will prevail, expecting people to cope with certain forms of climate change, and that disablism will be extended, with the ones less affected being unwilling to accommodate the ones more affected beyond a certain point. This ableism/disablism will not only play itself out between high and low income countries, as Desmond Tutu described, but also within high income countries, as not every need will be accommodated. The disaster experience of disabled people is just one example. And there might be climate change consequences that one can only mitigate through high tech bodily adaptations that will not be available to many of the ones who are so far accommodated in high income countries. Desmond Tutu submits that adaptation apartheid might work for the fortunate ones in the short term, but will be destructive for them in the long term (United Nations Development Programme). Disability studies scholar Erik Leipoldt proposed that the disability perspective of interdependence is a practical guide from the margins for making new choices that may lead to a just and sustainable world—a concept that reduces the distance between each other and our environment (Leipoldt). This perspective rejects ableism and disablism as it plays itself out today, including adaptation apartheid. Planned adaptation involves four basic steps: information development and awareness-raising; planning and design; implementation; and monitoring and evaluation (Smit et al). Disabled people have important knowledge to contribute to these four basic steps that goes far beyond their community. Their understanding and acceptance of, for example, the concept of interdependence, is just one major contribution. Including the concept of interdependence within the set of tools that inform the four basic steps of adaptation and other facets of climate discourse has the potential to lead to a decrease of adaptation apartheid, and to increase the utility of the climate discourse for the global community as a whole. References African Ministerial Conference on the Environment. Nairobi Declaration on the African Process for Combating Climate Change. 2009. 26 Aug. 2009 ‹ http://www.unep.org/roa/Amcen/Amcen_Events/3rd_ss/Docs/nairobi-Decration-2009.pdf ›. American Association of Retired Persons. We Can Do Better: Lessons Learned for Protecting Older Persons in Disasters. 2009. 26 Aug. 2009 ‹ http://assets.aarp.org/rgcenter/il/better.pdf ›. Australian Human Rights Commission. “Climate Change Secretariat Excludes People with Disabilities.” 2008. 26 Aug. 2009 ‹ http://www.hreoc.gov.au/about/media/media_releases/2008/95_08.html ›. Bernhard, S., and M. McGeehin. “Municipal Heatwave Response Plans.” American Journal of Public Health 94 (2004): 1520-21. CARE International, the UN Office for the Coordination of Humanitarian Affairs, and Maplecroft. Humanitarian Implications of Climate Change: Mapping Emerging Trends and Risk Hotspots for Humanitarian Actors. CARE International, 2008. 26 Aug. 2009 ‹ http://www.careclimatechange.org/files/reports/Human_Implications_PolicyBrief.pdf ›, ‹ http://www.careclimatechange.org/files/reports/CARE_Human_Implications.pdf ›. "Disasters Are Always Inclusive: Persons with Disabilities in Humanitarian Emergency Situations." Bonn Declaration from the International Conference: Disasters Are Always Inclusive: Persons with Disabilities in Humanitarian Emergency Situations. 2007. 26 Aug. 2009 ‹ http://www.disabilityfunders.org/webfm_send/6, http://www.disabilityfunders.org/emergency_preparedness ›, ‹ http://bezev.de/bezev/aktuelles/index.htm ›. Ebi, K., and G. Meehl. Heatwaves and Global Climate Change: The Heat Is On: Climate Change and Heatwaves in the Midwest. 2007. 26 Aug. 2009 ‹ www.pewclimate.org/docUploads/Regional-Impacts-Midwest.pdf ›. Elwan, A. Poverty and Disability: A Survey of the Literature. Worldbank, Social Protection Discussion Paper Series (1999): 9932. 26 Aug. 2009 ‹ http://siteresources.worldbank.org/DISABILITY/Resources/Poverty/Poverty_and_Disability_A_Survey_of_the_Literature.pdf ›. Fjord, L., and L. Manderson. “Anthropological Perspectives on Disasters and Disability: An Introduction.” Human Organisation 68.1 (2009): 64-72. Health Canada. First Annual National Health and Climate Change Science and Policy Research Consensus Conference: How Will Climate Change Affect Priorities for Your Health Science and Policy Research? Health Canada, 2001. 26 Aug. 2009 ‹ http://www.hc-sc.gc.ca/ewh-semt/pubs/climat/research-agenda-recherche/population-eng.php ›. Hemingway, L., and M. Priestley. “Natural Hazards, Human Vulnerability and Disabling Societies: A Disaster for Disabled People?” The Review of Disability Studies (2006). 26 Aug. 2009 ‹ http://www.rds.hawaii.edu/counter/count.php?id=13 ›. Holstein, J., et al. “Were Less Disabled Patients the Most Affected by the 2003 Heatwave in Nursing Homes in Paris, France?” Journal of Public Health Advance 27.4 (2005): 359-65. Intergovernmental Panel on Climate Change. Climate Change 2007: Impacts, Adaptation and Vulnerability. 2007. 26 Aug. 2009 ‹ http://www.ipcc.ch/publications_and_data/publications_ipcc_fourth_assessment_report_wg2_report_impacts_adaptation_and_vulnerability.htm ›. Intergovernmental Panel on Climate Change. “Summary for Policymakers.” Eds. O. F. Canziani, J. P. Palutikof, P. J. van der Linden, C. E. Hanson, and M.L.Parry. Cambridge, UK: Cambridge University Press, 2007. 7-22. 26 Aug. 2009 ‹ http://www.ipcc.ch/pdf/assessment-report/ar4/wg2/ar4-wg2-spm.pdf ›. Intergovernmental Panel on Climate Change. IPCC Fourth Assessment Report Working Group III Report: Mitigation of Climate Change Glossary. 2007. 26 Aug. 2009 ‹ http://www.ipcc.ch/ipccreports/ar4-wg3.htm, http://www.ipcc.ch/pdf/assessment-report/ar4/wg3/ar4-wg3-annex1.pdf ›. Leipoldt, E. “Disability Experience: A Contribution from the Margins. Towards a Sustainable Future.” Journal of Futures Studies 10 (2006): 3-15. Miller, P., S. Parker and S. Gillinson. “Disablism: How to Tackle the Last Prejudice.” Demos, 2004. 26 Aug. 2009 ‹ http://www.demos.co.uk/files/disablism.pdf ›. Nakamura, K. “Disability, Destitution, and Disaster: Surviving the 1995 Great Hanshin Earthquake in Japan.” Human Organisation 68.1 (2009): 82-88. National Council on Disability, National Council on Independent Living, National Organization on Disability, and National Spinal Cord Injury Association and the Paralyzed Veterans of America. Emergency Management and People with Disabilities: before, during and after Congressional Briefing, 10 November 2005. 26 Aug. 2009 ‹ http://www.ncd.gov/newsroom/publications/2005/transcript_emergencymgt.htm ›. National Council on Disability. National Council on Disability on Hurricane Katrina Affected Areas. 2005. 26 Aug. 2009 ‹ http://www.ncd.gov/newsroom/publications/2005/katrina2.htm ›. National Research Council of Canada. From Impacts to Adaptation: Canada in a Changing Climate 2007. 26 Aug. 2009 ‹ http://adaptation.nrcan.gc.ca/assess/2007/pdf/full-complet_e.pdf ›. Nippert, I. and G. Wolff. “Ethik und Genetik: Ergebnisse der Umfrage zu Problemaspekten angewandter Humangenetik 1994-1996, 37 Länder.” Medgen 11 (1999): 53-61. Participants of the Nuclear Winter: The Anthropology of Human Survival Session. Proceedings of the 84th American Anthropological Association's Annual Meeting. Washington, D.C., 6 Dec. 1985. 26 Aug. 2009 ‹ http://www.fas.org/sgp/othergov/doe/lanl/lib-www/la-pubs/00173165.pdf ›. Scope. “Most Britons Think Others View Disabled People ‘As Inferior’.” 2009. 26 Aug. 2009 ‹ http://www.scope.org.uk/cgi-bin/np/viewnews.cgi?id=1244379033, http://www.comres.co.uk/resources/7/Social%20Polls/Scope%20PublicPoll%20Results%20May09.pdf ›. Smit, B., et al. “The Science of Adaptation: A Framework for Assessment.” Mitigation and Adaptation Strategies for Global Change 4 (1999): 199-213. Smit, B., and J. Wandel. “Adaptation, Adaptive Capacity and Vulnerability.” Global Environmental Change 16 (2006): 282-92. Sunday Morning Herald. “Who Lives and Dies in Britain after the Bomb.” Sunday Morning Herald 1988. 26 Aug. 2009 ‹ http://news.google.com/newspapers?nid=1301&dat=19880511&id=wFYVAAAAIBAJ&sjid=kOQDAAAAIBAJ&pg=3909,113100 ›. United Nations Development Programme. Human Development Report 2007/2008: Fighting Climate Change – Human Solidarity in a Divided World. 2008. 26 Aug. 2009 ‹ http://hdr.undp.org/en/media/HDR_20072008_EN_Complete.pdf ›. Wolbring, Gregor. “Is There an End to Out-Able? Is There an End to the Rat Race for Abilities?” M/C Journal 11.3 (2008). 26 Aug. 2009 ‹ http://journal.media-culture.org.au/index.php/mcjournal/article/viewArticle/57 ›. Wolbring, Gregor. “Why NBIC? Why Human Performance Enhancement?” Innovation: The European Journal of Social Science Research 21.1 (2008): 25-40.

Abstract:

Introduction A snapshot, not unlike countless photographs likely to be found in any number of family albums, shows two figures sitting on a park bench: an elderly and amiable looking man grins beneath the rim of a golf cap; a young boy of twelve smiles wide for the camera — a rather banal scene, captured on film. And yet, this seemingly innocent and unexceptional photograph was the site of a remarkable and wide ranging discourse — encompassing American conservatism, celebrity politics, and the end of the Cold War — as the image circulated around the globe during the weeklong state funeral of Ronald Wilson Reagan, 40th president of the United States. Taken in 1997 by the young boy’s grandfather, Ukrainian immigrant Yakov Ravin, during a chance encounter with the former president, the snapshot is believed to be the last public photograph of Ronald Reagan. Published on the occasion of the president’s death, the photograph made “instant celebrities” of the boy, now a twenty-year-old college student, Rostik Denenburg and his grand dad. Throughout the week of Reagan’s funeral, the two joined a chorus of dignitaries, politicians, pundits, and “ordinary” Americans praising Ronald Reagan: “The Great Communicator,” the man who defeated Communism, the popular president who restored America’s confidence, strength, and prosperity. Yes, it was mourning in America again. And the whole world was watching. Not since Princess Diana’s sudden (and unexpected) death, have we witnessed an electronic hagiography of such global proportions. Unlike Diana’s funeral, however, Reagan’s farewell played out in distinctly partisan terms. As James Ridgeway (2004) noted, the Reagan state funeral was “not only face-saving for the current administration, but also perhaps a mask for the American military debacle in Iraq. Not to mention a gesture of America’s might in the ‘war on terror.’” With non-stop media coverage, the weeklong ceremonies provided a sorely needed shot in the arm to the Bush re-election campaign. Still, whilst the funeral proceedings and the attendant media coverage were undeniably excessive in their deification of the former president, the historical white wash was not nearly so vulgar as the antiseptic send off Richard Nixon received back in 1994. That is to say, the piety of the Nixon funeral was at once startling and galling to many who reviled the man (Lapham). By contrast, given Ronald Reagan’s disarming public persona, his uniquely cordial relationship with the national press corps, and most notably, his handler’s mastery of media management techniques, the Reagan idolatry was neither surprising nor unexpected. In this brief essay, I want to consider Reagan’s funeral, and his legacy, in relation to what cultural critics, referring to the production of celebrity, have described as “fame games” (Turner, Bonner & Marshall). Specifically, I draw on the concept of “flashpoints” — moments of media excess surrounding a particular personage — in consideration of the Reagan funeral. Throughout, I demonstrate how Reagan’s death and the attendant media coverage epitomize this distinctive feature of contemporary culture. Furthermore, I observe Reagan’s innovative approaches to electoral politics in the age of television. Here, I suggest that Reagan’s appropriation of the strategies and techniques associated with advertising, marketing and public relations were decisive, not merely in terms of his electoral success, but also in securing his lasting fame. I conclude with some thoughts on the implications of Reagan’s legacy on historical memory, contemporary politics, and what neoconservatives, the heirs of the Reagan Revolution, gleefully describe as the New American Century. The Magic Hour On the morning of 12 June 2004, the last day of the state funeral, world leaders eulogized Reagan, the statesmen, at the National Cathedral in Washington, D.C. Among the A-List political stars invited to speak were Margaret Thatcher, former president George H. W. Bush and, to borrow Arundhati Roi’s useful phrase, “Bush the Lesser.” Reagan’s one-time Cold War adversary, Mikhail Gorbachev, as well as former Democratic presidents, Jimmy Carter and Bill Clinton were also on hand, but did not have speaking parts. Former Reagan administration officials, Supreme Court justices, and congressional representatives from both sides of the aisle rounded out a guest list that read like a who’s who of the American political class. All told, Reagan’s weeklong sendoff was a state funeral at its most elaborate. It had it all—the flag draped coffin, the grieving widow, the riderless horse, and the procession of mourners winding their way through the Rotunda of the US Capitol. In this last regard, Reagan joined an elite group of seven presidents, including four who died by assassination — Abraham Lincoln, James Garfield, William McKinley and John F. Kennedy — to be honored by having his remains lie in state in the Rotunda. But just as the deceased president was product of the studio system, so too, the script for the Gipper’s swan song come straight out of Hollywood. Later that day, the Reagan entourage made one last transcontinental flight back to the presidential library in Simi Valley, California for a private funeral service at sunset. In Hollywood parlance, the “magic hour” refers to the quality of light at dusk. It is an ideal, but ephemeral time favored by cinematographers, when the sunlight takes on a golden glow lending grandeur, nostalgia, and oftentimes, a sense of closure to a scene. This was Ronald Reagan’s final moment in the sun: a fitting end for an actor of the silver screen, as well as for the president who mastered televisual politics. In a culture so thoroughly saturated with the image, even the death of a minor celebrity is an occasion to replay film clips, interviews, paparazzi photos and the like. Moreover, these “flashpoints” grow in intensity and frequency as promotional culture, technological innovation, and the proliferation of new media outlets shape contemporary media culture. They are both cause and consequence of these moments of media excess. And, as Turner, Bonner and Marshall observe, “That is their point. It is their disproportionate nature that makes them so important: the scale of their visibility, their overwhelmingly excessive demonstration of the power of the relationship between mass-mediated celebrities and the consumers of popular culture” (3-4). B-Movie actor, corporate spokesman, state governor and, finally, US president, Ronald Reagan left an extraordinary photographic record. Small wonder, then, that Reagan’s death was a “flashpoint” of the highest order: an orgy of images, a media spectacle waiting to happen. After all, Reagan appeared in over 50 films during his career in Hollywood. Publicity stills and clips from Reagan’s film career, including Knute Rockne, All American, the biopic that earned Reagan his nickname “the Gipper”, King’s Row, and Bedtime for Bonzo provided a surreal, yet welcome respite from television’s obsessive (some might say morbidly so) live coverage of Reagan’s remains making their way across country. Likewise, archival footage of Reagan’s political career — most notably, images of the 1981 assassination attempt; his quip “not to make age an issue” during the 1984 presidential debate; and his 1987 speech at the Brandenburg Gate demanding that Soviet President Gorbachev, “tear down this wall” — provided the raw materials for press coverage that thoroughly dominated the global mediascape. None of which is to suggest, however, that the sheer volume of Reagan’s photographic record is sufficient to account for the endless replay and reinterpretation of Reagan’s life story. If we are to fully comprehend Reagan’s fame, we must acknowledge his seminal engagement with promotional culture, “a professional articulation between the news and entertainment media and the sources of publicity and promotion” (Turner, Bonner & Marshall 5) in advancing an extraordinary political career. Hitting His Mark In a televised address supporting Barry Goldwater’s nomination for the presidency delivered at the 1964 Republican Convention, Ronald Reagan firmly established his conservative credentials and, in so doing, launched one of the most remarkable and influential careers in American politics. Political scientist Gerard J. De Groot makes a compelling case that the strategy Reagan and his handlers developed in the 1966 California gubernatorial campaign would eventually win him the presidency. The centerpiece of this strategy was to depict the former actor as a political outsider. Crafting a persona he described as “citizen politician,” Reagan’s great appeal and enormous success lie in his uncanny ability to project an image founded on traditional American values of hard work, common sense and self-determination. Over the course of his political career, Reagan’s studied optimism and “no-nonsense” approach to public policy would resonate with an electorate weary of career politicians. Charming, persuasive, and seemingly “authentic,” Reagan ran gubernatorial and subsequent presidential campaigns that were distinctive in that they employed sophisticated public relations and marketing techniques heretofore unknown in the realm of electoral politics. The 1966 Reagan gubernatorial campaign took the then unprecedented step of employing an advertising firm, Los Angeles-based Spencer-Roberts, in shaping the candidate’s image. Leveraging their candidate’s ease before the camera, the Reagan team crafted a campaign founded upon a sophisticated grasp of the television industry, TV news routines, and the medium’s growing importance to electoral politics. For instance, in the days before the 1966 Republican primary, the Reagan team produced a five-minute film using images culled from his campaign appearances. Unlike his opponent, whose television spots were long-winded, amateurish and poorly scheduled pieces that interrupted popular programs, like Johnny Carson’s Tonight Show, Reagan’s short film aired in the early evening, between program segments (De Groot). Thus, while his opponent’s television spot alienated viewers, the Reagan team demonstrated a formidable appreciation not only for televisual style, but also, crucially, a sophisticated understanding of the nuances of television scheduling, audience preferences and viewing habits. Over the course of his political career, Reagan refined his media driven, media directed campaign strategy. An analysis of his 1980 presidential campaign reveals three dimensions of Reagan’s increasingly sophisticated media management strategy (Covington et al.). First, the Reagan campaign carefully controlled their candidate’s accessibility to the press. Reagan’s penchant for potentially damaging off-the-cuff remarks and factual errors led his advisors to limit journalists’ interactions with the candidate. Second, the character of Reagan’s public appearances, including photo opportunities and especially press conferences, grew more formal. Reagan’s interactions with the press corps were highly structured affairs designed to control which reporters were permitted to ask questions and to help the candidate anticipate questions and prepare responses in advance. Finally, the Reagan campaign sought to keep the candidate “on message.” That is to say, press releases, photo opportunities and campaign appearances focused on a single, consistent message. This approach, known as the Issue of the Day (IOD) media management strategy proved indispensable to advancing the administration’s goals and achieving its objectives. Not only was the IOD strategy remarkably effective in influencing press coverage of the Reagan White House, this coverage promoted an overwhelmingly positive image of the president. As the weeklong funeral amply demonstrated, Reagan was, and remains, one of the most popular presidents in modern American history. Reagan’s popular (and populist) appeal is instructive inasmuch as it illuminates the crucial distinction between “celebrity and its premodern antecedent, fame” observed by historian Charles L. Ponce de Leone (13). Whereas fame was traditionally bestowed upon those whose heroism and extraordinary achievements distinguished them from common people, celebrity is a defining feature of modernity, inasmuch as celebrity is “a direct outgrowth of developments that most of us regard as progressive: the spread of the market economy and the rise of democratic, individualistic values” (Ponce de Leone 14). On one hand, then, Reagan’s celebrity reflects his individualism, his resolute faith in the primacy of the market, and his defense of “traditional” (i.e. democratic) American values. On the other hand, by emphasizing his heroic, almost supernatural achievements, most notably his vanquishing of the “Evil Empire,” the Reagan mythology serves to lift him “far above the common rung of humanity” raising him to “the realm of the divine” (Ponce de Leone 14). Indeed, prior to his death, the Reagan faithful successfully lobbied Congress to create secular shrines to the standard bearer of American conservatism. For instance, in 1998, President Clinton signed a bill that officially rechristened one of the US capitol’s airports to Ronald Reagan Washington National Airport. More recently, conservatives working under the aegis of the Ronald Reagan Legacy Project have called for the creation of even more visible totems to the Reagan Revolution, including replacing Franklin D. Roosevelt’s profile on the dime with Reagan’s image and, more dramatically, inscribing Reagan in stone, alongside Washington, Jefferson, Lincoln and Teddy Roosevelt at Mount Rushmore (Gordon). Therefore, Reagan’s enduring fame rests not only on the considerable symbolic capital associated with his visual record, but also, increasingly, upon material manifestations of American political culture. The High Stakes of Media Politics What are we to make of Reagan’s fame and its implications for America? To begin with, we must acknowledge Reagan’s enduring influence on modern electoral politics. Clearly, Reagan’s “citizen politician” was a media construct — the masterful orchestration of ideological content across the institutional structures of news, public relations and marketing. While some may suggest that Reagan’s success was an anomaly, a historical aberration, a host of politicians, and not a few celebrities — Bill Clinton, George W. Bush, and Arnold Schwarzenegger among them — emulate Reagan’s style and employ the media management strategies he pioneered. Furthermore, we need to recognize that the Reagan mythology that is so thoroughly bound up in his approach to media/politics does more to obscure, rather than illuminate the historical record. For instance, in her (video taped) remarks at the funeral service, Margaret Thatcher made the extraordinary claim — a central tenet of the Reagan Revolution — that Ronnie won the cold war “without firing a shot.” Such claims went unchallenged, at least in the establishment press, despite Reagan’s well-documented penchant for waging costly and protracted proxy wars in Afghanistan, Africa, and Central America. Similarly, the Reagan hagiography failed to acknowledge the decisive role Gorbachev and his policies of “reform” and “openness” — Perestroika and Glasnost — played in the ending of the Cold War. Indeed, Reagan’s media managed populism flies in the face of what radical historian Howard Zinn might describe as a “people’s history” of the 1980s. That is to say, a broad cross-section of America — labor, racial and ethnic minorities, environmentalists and anti-nuclear activists among them — rallied in vehement opposition to Reagan’s foreign and domestic policies. And yet, throughout the weeklong funeral, the divisiveness of the Reagan era went largely unnoted. In the Reagan mythology, then, popular demonstrations against an unprecedented military build up, the administration’s failure to acknowledge, let alone intervene in the AIDS epidemic, and the growing disparity between rich and poor that marked his tenure in office were, to borrow a phrase, relegated to the dustbin of history. In light of the upcoming US presidential election, we ought to weigh how Reagan’s celebrity squares with the historical record; and, equally important, how his legacy both shapes and reflects the realities we confront today. Whether we consider economic and tax policy, social services, electoral politics, international relations or the domestic culture wars, Reagan’s policies and practices continue to determine the state of the union and inform the content and character of American political discourse. Increasingly, American electoral politics turns on the pithy soundbite, the carefully orchestrated pseudo-event, and a campaign team’s unwavering ability to stay on message. Nowhere is this more evident than in Ronald Reagan’s unmistakable influence upon the current (and illegitimate) occupant of the White House. References Covington, Cary R., Kroeger, K., Richardson, G., and J. David Woodward. “Shaping a Candidate’s Image in the Press: Ronald Reagan and the 1980 Presidential Election.” Political Research Quarterly 46.4 (1993): 783-98. De Groot, Gerard J. “‘A Goddamed Electable Person’: The 1966 California Gubernatorial Campaign of Ronald Reagan.” History 82.267 (1997): 429-48. Gordon, Colin. “Replace FDR on the Dime with Reagan?” History News Network 15 December, 2003. http://hnn.us/articles/1853.html>. Lapham, Lewis H. “Morte de Nixon – Death of Richard Nixon – Editorial.” Harper’s Magazine (July 1994). http://www.harpers.org/MorteDeNixon.html>. Ponce de Leon, Charles L. Self-Exposure: Human-Interest Journalism and the Emergence of Celebrity in America, 1890-1940. Chapel Hill: U of North Carolina P, 2002. Ridgeway, James. “Bush Takes a Ride in Reagan’s Wake.” Village Voice (10 June 2004). http://www.villagevoice.com/issues/0423/mondo5.php>. Turner, Graeme, Frances Bonner, and P. David Marshall. Fame Games: The Production of Celebrity in Australia. Cambridge: Cambridge UP, 2000. Zinn, Howard. The Peoples’ History of the United States: 1492-Present. New York: Harper Perennial, 1995. Citation reference for this article MLA Style Howley, Kevin. "Always Famous: Or, The Electoral Half-Life of Ronald Reagan." M/C Journal 7.5 (2004). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0411/17-howley.php>. APA Style Howley, K. (Nov. 2004) "Always Famous: Or, The Electoral Half-Life of Ronald Reagan," M/C Journal, 7(5). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0411/17-howley.php>.

Abstract:

To sin by silence, when we should protest,Makes cowards out of men.— Ella Wheeler WilcoxProtest is culturally entwined in historical and juro-political realities and is a fundamental element of the exercise of individual and collective rights. As our title notes, while there are currently many ‘protests in progress’ around the world, there is also a great deal of ‘progress in protest’ in terms of what protests look like, their scale and number, how they are formed and conducted, their goals, how they can be studied, as well as the varying responses formed in relation to protest. The etymology of protest associates two important dynamics pertaining to the topic. Firstly, a protest is something that is put forward, forth, or toward the front (from the Latin pro); essentially, it is in one manner or another, made publically. Secondly, it suggests that a person or persons have beared witness (testis) and instead of remaining silent, have made a declaration or assertion (testari). In other words, someone has made public their disapproval or objection. The nine articles that comprise this issue of M/C Journal on ‘protest’ reminds us of these salient elements of protest. Each, in their own way, highlight the importance of not remaining silent when faced with an injustice or in order to promote social change. As Bill McKibben (7) outlines in his foreword to an excellent collection of protest documents, ‘voices of protest ... are often precisely what propels human civilisation forward and allows it to become unstuck’. However, not all forms of contemporary protest shares ideological or progressive aims. Here, we might consider the emergence of contentious formations such as the alt-right and antifa, what is considered ‘fake’ or ‘real’, and ongoing conflicts between notions of individual and collective rights and state sovereignty.This modest but insightful collection demonstrates the broad scope of this field of inquiry. This issue explores the intersections among social justice, identity and communications technology, as well as the convergences and divergences in the form, function and substance of protest. Through an analysis of protest’s relationship to media, the author’s highlight the possibilities of protest to effect social change. The issue begins with Lakota screenwriter and activist Floris White Bull’s (Floris Ptesáŋ Huŋká) discussion of the documentary AWAKE, a Dream from Standing Rock (2017) and the #NODAPL protest. The film, split into three parts, takes a poignant and quite personal look at the native-led peaceful resistance at the Standing Rock Sioux Reservation in North Dakota in 2016. This protest involved tens of thousands of activists from all over the world who opposed the construction of the Dakota Access Pipeline (DAPL) which was to transport fracked oil directly underneath the Missouri River and through sovereign Lakota land (see Image 1). However, the events at Standing Rock were not a single-issue protest and brought activists together over a range of interrelated issues including environmental protection, human rights, water security, community health and Native American sovereignty. The Water Protectors were also forced to contest racist and disparaging media representations. As such, Standing Rock remains a site of cultural exchange and learning. These protests are not historical, but instead, are an ongoing struggle. The film AWAKE is important as testimony to the injustices at Standing Rock. A short description of the film is first provided in order to provide some additional context to perspectives addressed in the film. From there, White Bull has been invited to respond to questions posed by the editors regarding the Standing Rock Protests and documentary films such as AWAKE. As an Indigenous person fighting for justice, White Bull reminds readers that ‘[t]he path forward is the same as it has always been – holding on to our goals, values and dignity with resilience’.Image 1: Dakota Access Pipeline Protesters, 2016. Photo credit: Indigenous Environmental Network.Cat Pausé and Sandra Grey use an example of fat shaming to investigate how media impacts body politics and determines who is enfranchised to voice public dissent. Media becomes a mechanism for policing and governing bodily norms and gendered identities. As well as outlining a brief history of feminist body activism, the authors draw on personal experience and interview material with activists to reflect on fat embodiment and politics. Also informed by intersectional approaches, their work alerts us to the diverse vectors by which injustice and oppression fall on some bodies differently as well as the diverse bodies assembled in any crowd.Greg Watson suggests that “[c]ontemporary societies are increasingly becoming sites in which it is more difficult for people to respectfully negotiate disagreements about human diversity”. Drawing on his experiences organising Human Libraries throughout Australia, Watson argues these spaces create opportunities for engaging with difference. In this sense Human Libraries can be considered sites which protest the micropublics’ “codes of civility” which produce everyday marginalisations of difference.Micropolitics and creative forms of protest are also central to Ella Cutler, Jacqueline Gothe, and Alexandra Crosby’s article. The author’s consider three design projects which seek to facilitate ethical communication with diverse communities. Drawing on Guy Julier’s tactics for activist design, each project demonstrates the value of slowing down in order to pay attention to experience. In this way, research through design offers a reflexive means for engaging social change.Research practices are also central to making visible community resistance. Anthony McCosker and Timothy Graham consider the role of social networking in urban protests through the campaign to save the iconic Melbourne music venue The Palace (see Image 2). Their article considers the value of social media data and analytics in relation to the court proceedings and trial processes. Given the centrality of social media to activist campaigns their reflections provide a timely evaluation of how data publics are constituted and their ongoing legacy.Image 2: Melbourne’s Palace Theatre before demolition. Photo Credit: Melbourne Heritage Action.For Marcelina Piotrowski pleasure is central to understanding data production and protest. She draws on a Deleuze and Guattarian framework in order to consider protests against oil pipelines in British Columbia. Importantly, through this theoretical framework of ‘data desires’, pleasure is not something owned by the individual subject but rather holds the potential to construct generative social collectivities. This is traced through three different practices: deliberation in online forums; citizen science and social media campaigns. This has important implications for understanding environmental issues and our own enfolding within them. Nadine Kozak takes a look at how Online Service Providers (OSPs) have historically used internet ‘blackouts’ in order to protest United States government regulations. Kozak points to protests against the Communications Decency Act (1996) which sought to regulate online p*rnographic material and the Stop Online Piracy Act (2011) which proposed increased federal government power to take action against online copyright infringement. Recently, the United States Congress recently passed the Fight Online Sex Trafficking Act (FOSTA) and the Stop Enabling Sex Traffickers Act (SESTA), which hold OSPs liable for third-party content including advertising for prostitution. However, despite condemnation from the Department of Justice and trafficking victims, OSPs did not utilise blackouts as a means to protest these new measures. Kozak concludes that the decision to whether or not to utilise blackout protests is dependent on the interests of technology companies and large OSPs. It is evident that most especially since Donald Trump popularised the term, ‘fake news’ has taken a centre stage in discussions concerning media. In fact, the lines between what is fake and what is official have become blurred. Most recently, QAnon proponents have been attending Trump rallies and speeches giving further visibility to various conspiracy narratives stemming from online message boards (see Image 3). Marc Tuters, Emilija Jokubauskaitė, and Daniel Bach establishe a clear timeline of events in order to trace the origins of ‘#Pizzagate’; a 2016 conspiracy theory that falsely claimed that several U.S. restaurants and high-ranking officials of the Democratic Party were connected with human trafficking and an alleged child-sex ring. The authors investigate the affordances of 4chan to unpack how the site’s anonymity, rapid temporality and user collectivisation were instrumental in creating ‘bullsh*t’; a usage which the authors suggest is a “technical term for persuasive speech unconcerned with veracity”. This provides an understanding of how alt-right communities are assembled and motivated in a post-truth society. Image 3: QAnon proponents at Trump rally in Tampa, 31 July 2018. Photo credit: Kirby Wilson, Tampa Bay Times.Finally, Colin Salter analyses protests for animal rights as a lens to critique notions of national identity and belonging. Protests on whaling in the Southern Ocean (see Image 4) and live export trade from Australia continue to be highly contested political issues. Salter reflects on the ABC’s 2011 exposé into Australian live animal exports to Indonesia and the 2014 hearings at the International Court of Justice into Japanese whaling. Salter then traces the common elements between animal rights campaigns in order to demonstrate the manner in which the physical bodies of animals, their treatment, and the debate surrounding that treatment become sites for mapping cultural identity, nationhood, and sovereignty. Here, Salter suggests that such inquiry is useful for promoting broader consideration of efficacious approaches to animal advocacy and social change.Image 4: The ship Bob Barker, rammed by the Japanese whaling vessel Nishin Maru. Photo credit: Sea Shepherd Facebook Page. As indicated in the opening paragraphs, it is crucial for people committed to social justice to publically raise their voices in protest. As such, we would like to thank each of the authors for their important contributions to this issue on ‘protest’. In its own way, each contribution serves doubly as a form of protest and a means to understand the topic more clearly. There is solidarity evidenced in this issue. Taken as a whole, these articles attest to the importance of understanding protest and social change.ReferencesMcKibben, B. "Foreword." Voices of Protest: Documents of Courage and Dissent. Eds. Frank Lowenstein, Sheryl Lechner, and Erik Bruun. New York: Black Dog & Leventhal Publishers, 2007. 7-8.Wilcox, E.W. "Protest." Poems of Problems. Chicago: W.B. Conkey Company, 1914.

Abstract:

The Australian Government has been actively evaluating how best to merge the functions of the Australian Communications Authority (ACA) and the Australian Broadcasting Authority (ABA) for around two years now. Broadly, the reason for this is an attempt to keep pace with the communications media transformations we reduce to the term “convergence.” Mounting pressure for restructuring is emerging as a site of turf contestation: the possibility of a regulatory “one-stop shop” for governments (and some industry players) is an end game of considerable force. But, from a public interest perspective, the case for a converged regulator needs to make sense to audiences using various media, as well as in terms of arguments about global, industrial, and technological change. This national debate about the institutional reshaping of media regulation is occurring within a wider global context of transformations in social, technological, and politico-economic frameworks of open capital and cultural markets, including the increasing prominence of international economic organisations, corporations, and Free Trade Agreements (FTAs). Although the recently concluded FTA with the US explicitly carves out a right for Australian Governments to make regulatory policy in relation to existing and new media, considerable uncertainty remains as to future regulatory arrangements. A key concern is how a right to intervene in cultural markets will be sustained in the face of cultural, politico-economic, and technological pressures that are reconfiguring creative industries on an international scale. While the right to intervene was retained for the audiovisual sector in the FTA, by contrast, it appears that comparable unilateral rights to intervene will not operate for telecommunications, e-commerce or intellectual property (DFAT). Blurring Boundaries A lack of certainty for audiences is a by-product of industry change, and further blurs regulatory boundaries: new digital media content and overlapping delivering technologies are already a reality for Australia’s media regulators. These hypothetical media usage scenarios indicate how confusion over the appropriate regulatory agency may arise: 1. playing electronic games that use racist language; 2. being subjected to deceptive or misleading pop-up advertising online 3. receiving messaged imagery on your mobile phone that offends, disturbs, or annoys; 4. watching a program like World Idol with SMS voting that subsequently raises charging or billing issues; or 5. watching a new “reality” TV program where products are being promoted with no explicit acknowledgement of the underlying commercial arrangements either during or at the end of the program. These are all instances where, theoretically, regulatory mechanisms are in place that allow individuals to complain and to seek some kind of redress as consumers and citizens. In the last scenario, in commercial television under the sector code, no clear-cut rules exist as to the precise form of the disclosure—as there is (from 2000) in commercial radio. It’s one of a number of issues the peak TV industry lobby Commercial TV Australia (CTVA) is considering in their review of the industry’s code of practice. CTVA have proposed an amendment to the code that will simply formalise the already existing practice . That is, commercial arrangements that assist in the making of a program should be acknowledged either during programs, or in their credits. In my view, this amendment doesn’t go far enough in post “cash for comment” mediascapes (Dwyer). Audiences have a right to expect that broadcasters, production companies and program celebrities are open and transparent with the Australian community about these kinds of arrangements. They need to be far more clearly signposted, and people better informed about their role. In the US, the “Commercial Alert” <http://www.commercialalert.org/> organisation has been lobbying the Federal Communications Commission and the Federal Trade Commission to achieve similar in-program “visual acknowledgements.” The ABA’s Commercial Radio Inquiry (“Cash-for-Comment”) found widespread systemic regulatory failure and introduced three new standards. On that basis, how could a “standstill” response by CTVA, constitute best practice for such a pervasive and influential medium as contemporary commercial television? The World Idol example may lead to confusion for some audiences, who are unsure whether the issues involved relate to broadcasting or telecommunications. In fact, it could be dealt with as a complaint to the Telecommunication Industry Ombudsman (TIO) under an ACA registered, but Australian Communications Industry Forum (ACIF) developed, code of practice. These kind of cross-platform issues may become more vexed in future years from an audience’s perspective, especially if reality formats using on-screen premium rate service numbers invite audiences to participate, by sending MMS (multimedia messaging services) images or short video grabs over wireless networks. The political and cultural implications of this kind of audience interaction, in terms of access, participation, and more generally the symbolic power of media, may perhaps even indicate a longer-term shift in relations with consumers and citizens. In the Internet example, the Australian Competition and Consumer Commission’s (ACCC) Internet advertising jurisdiction would apply—not the ABA’s “co-regulatory” Internet content regime as some may have thought. Although the ACCC deals with complaints relating to Internet advertising, there won’t be much traction for them in a more complex issue that also includes, say, racist or religious bigotry. The DVD example would probably fall between the remits of the Office of Film and Literature Classification’s (OFLC) new “convergent” Guidelines for the Classification of Film and Computer Games and race discrimination legislation administered by the Human Rights and Equal Opportunity Commission (HREOC). The OFLC’s National Classification Scheme is really geared to provide consumer advice on media products that contain sexual and violent imagery or coarse language, rather than issues of racist language. And it’s unlikely that a single person would have the locus standito even apply for a reclassification. It may fall within the jurisdiction of the HREOC depending on whether it was played in public or not. Even then it would probably be considered exempt on free speech grounds as an “artistic work.” Unsolicited, potentially illegal, content transmitted via mobile wireless devices, in particular 3G phones, provide another example of content that falls between the media regulation cracks. It illustrates a potential content policy “turf grab” too. Image-enabled mobile phones create a variety of novel issues for content producers, network operators, regulators, parents and viewers. There is no one government media authority or agency with a remit to deal with this issue. Although it has elements relating to the regulatory activities of the ACA, the ABA, the OFLC, the TIO, and TISSC, the combination of illegal or potentially prohibited content and its carriage over wireless networks positions it outside their current frameworks. The ACA may argue it should have responsibility for this kind of content since: it now enforces the recently enacted Commonwealth anti-Spam laws; has registered an industry code of practice for unsolicited content delivered over wireless networks; is seeking to include ‘adult’ content within premium rate service numbers, and, has been actively involved in consumer education for mobile telephony. It has also worked with TISSC and the ABA in relation to telephone sex information services over voice networks. On the other hand, the ABA would probably argue that it has the relevant expertise for regulating wirelessly transmitted image-content, arising from its experience of Internet and free and subscription TV industries, under co-regulatory codes of practice. The OFLC can also stake its claim for policy and compliance expertise, since the recently implemented Guidelines for Classification of Film and Computer Games were specifically developed to address issues of industry convergence. These Guidelines now underpin the regulation of content across the film, TV, video, subscription TV, computer games and Internet sectors. Reshaping Institutions Debates around the “merged regulator” concept have occurred on and off for at least a decade, with vested interests in agencies and the executive jockeying to stake claims over new turf. On several occasions the debate has been given renewed impetus in the context of ruling conservative parties’ mooted changes to the ownership and control regime. It’s tended to highlight demarcations of remit, informed as they are by historical and legal developments, and the gradual accretion of regulatory cultures. Now the key pressure points for regulatory change include the mere existence of already converged single regulatory structures in those countries with whom we tend to triangulate our policy comparisons—the US, the UK and Canada—increasingly in a context of debates concerning international trade agreements; and, overlaying this, new media formats and devices are complicating existing institutional arrangements and legal frameworks. The Department of Communications, Information Technology & the Arts’s (DCITA) review brief was initially framed as “options for reform in spectrum management,” but was then widened to include “new institutional arrangements” for a converged regulator, to deal with visual content in the latest generation of mobile telephony, and other image-enabled wireless devices (DCITA). No other regulatory agencies appear, at this point, to be actively on the Government’s radar screen (although they previously have been). Were the review to look more inclusively, the ACCC, the OFLC and the specialist telecommunications bodies, the TIO and the TISSC may also be drawn in. Current regulatory arrangements see the ACA delegate responsibility for broadcasting services bands of the radio frequency spectrum to the ABA. In fact, spectrum management is the turf least contested by the regulatory players themselves, although the “convergent regulator” issue provokes considerable angst among powerful incumbent media players. The consensus that exists at a regulatory level can be linked to the scientific convention that holds the radio frequency spectrum is a continuum of electromagnetic bands. In this view, it becomes artificial to sever broadcasting, as “broadcasting services bands” from the other remaining highly diverse communications uses, as occurred from 1992 when the Broadcasting Services Act was introduced. The prospect of new forms of spectrum charging is highly alarming for commercial broadcasters. In a joint submission to the DCITA review, the peak TV and radio industry lobby groups have indicated they will fight tooth and nail to resist new regulatory arrangements that would see a move away from the existing licence fee arrangements. These are paid as a sliding scale percentage of gross earnings that, it has been argued by Julian Thomas and Marion McCutcheon, “do not reflect the amount of spectrum used by a broadcaster, do not reflect the opportunity cost of using the spectrum, and do not provide an incentive for broadcasters to pursue more efficient ways of delivering their services” (6). An economic rationalist logic underpins pressure to modify the spectrum management (and charging) regime, and undoubtedly contributes to the commercial broadcasting industry’s general paranoia about reform. Total revenues collected by the ABA and the ACA between 1997 and 2002 were, respectively, $1423 million and $3644.7 million. Of these sums, using auction mechanisms, the ABA collected $391 million, while the ACA collected some $3 billion. The sale of spectrum that will be returned to the Commonwealth by television broadcasters when analog spectrum is eventually switched off, around the end of the decade, is a salivating prospect for Treasury officials. The large sums that have been successfully raised by the ACA boosts their position in planning discussions for the convergent media regulatory agency. The way in which media outlets and regulators respond to publics is an enduring question for a democratic polity, irrespective of how the product itself has been mediated and accessed. Media regulation and civic responsibility, including frameworks for negotiating consumer and citizen rights, are fundamental democratic rights (Keane; Tambini). The ABA’s Commercial Radio Inquiry (‘cash for comment’) has also reminded us that regulatory frameworks are important at the level of corporate conduct, as well as how they negotiate relations with specific media audiences (Johnson; Turner; Gordon-Smith). Building publicly meaningful regulatory frameworks will be demanding: relationships with audiences are often complex as people are constructed as both consumers and citizens, through marketised media regulation, institutions and more recently, through hybridising program formats (Murdock and Golding; Lumby and Probyn). In TV, we’ve seen the growth of infotainment formats blending entertainment and informational aspects of media consumption. At a deeper level, changes in the regulatory landscape are symptomatic of broader tectonic shifts in the discourses of governance in advanced information economies from the late 1980s onwards, where deregulatory agendas created an increasing reliance on free market, business-oriented solutions to regulation. “Co-regulation” and “self-regulation’ became the preferred mechanisms to more direct state control. Yet, curiously contradicting these market transformations, we continue to witness recurring instances of direct intervention on the basis of censorship rationales (Dwyer and Stockbridge). That digital media content is “converging” between different technologies and modes of delivery is the norm in “new media” regulatory rhetoric. Others critique “visions of techno-glory,” arguing instead for a view that sees fundamental continuities in media technologies (Winston). But the socio-cultural impacts of new media developments surround us: the introduction of multichannel digital and interactive TV (in free-to-air and subscription variants); broadband access in the office and home; wirelessly delivered content and mobility, and, as Jock Given notes, around the corner, there’s the possibility of “an Amazon.Com of movies-on-demand, with the local video and DVD store replaced by online access to a distant server” (90). Taking a longer view of media history, these changes can be seen to be embedded in the global (and local) “innovation frontier” of converging digital media content industries and its transforming modes of delivery and access technologies (QUT/CIRAC/Cutler & Co). The activities of regulatory agencies will continue to be a source of policy rivalry and turf contestation until such time as a convergent regulator is established to the satisfaction of key players. However, there are risks that the benefits of institutional reshaping will not be readily available for either audiences or industry. In the past, the idea that media power and responsibility ought to coexist has been recognised in both the regulation of the media by the state, and the field of communications media analysis (Curran and Seaton; Couldry). But for now, as media industries transform, whatever the eventual institutional configuration, the evolution of media power in neo-liberal market mediascapes will challenge the ongoing capacity for interventions by national governments and their agencies. Works Cited Australian Broadcasting Authority. Commercial Radio Inquiry: Final Report of the Australian Broadcasting Authority. Sydney: ABA, 2000. Australian Communications Information Forum. Industry Code: Short Message Service (SMS) Issues. Dec. 2002. 8 Mar. 2004 <http://www.acif.org.au/__data/page/3235/C580_Dec_2002_ACA.pdf >. Commercial Television Australia. Draft Commercial Television Industry Code of Practice. Aug. 2003. 8 Mar. 2004 <http://www.ctva.com.au/control.cfm?page=codereview&pageID=171&menucat=1.2.110.171&Level=3>. Couldry, Nick. The Place of Media Power: Pilgrims and Witnesses of the Media Age. London: Routledge, 2000. Curran, James, and Jean Seaton. Power without Responsibility: The Press, Broadcasting and New Media in Britain. 6th ed. London: Routledge, 2003. Dept. of Communication, Information Technology and the Arts. Options for Structural Reform in Spectrum Management. Canberra: DCITA, Aug. 2002. ---. Proposal for New Institutional Arrangements for the ACA and the ABA. Aug. 2003. 8 Mar. 2004 <http://www.dcita.gov.au/Article/0,,0_1-2_1-4_116552,00.php>. Dept. of Foreign Affairs and Trade. Australia-United States Free Trade Agreement. Feb. 2004. 8 Mar. 2004 <http://www.dfat.gov.au/trade/negotiations/us_fta/outcomes/11_audio_visual.php>. Dwyer, Tim. Submission to Commercial Television Australia’s Review of the Commercial Television Industry’s Code of Practice. Sept. 2003. Dwyer, Tim, and Sally Stockbridge. “Putting Violence to Work in New Media Policies: Trends in Australian Internet, Computer Game and Video Regulation.” New Media and Society 1.2 (1999): 227-49. Given, Jock. America’s Pie: Trade and Culture After 9/11. Sydney: U of NSW P, 2003. Gordon-Smith, Michael. “Media Ethics After Cash-for-Comment.” The Media and Communications in Australia. Ed. Stuart Cunningham and Graeme Turner. Sydney: Allen and Unwin, 2002. Johnson, Rob. Cash-for-Comment: The Seduction of Journo Culture. Sydney: Pluto, 2000. Keane, John. The Media and Democracy. Cambridge: Polity, 1991. Lumby, Cathy, and Elspeth Probyn, eds. Remote Control: New Media, New Ethics. Melbourne: Cambridge UP, 2003. Murdock, Graham, and Peter Golding. “Information Poverty and Political Inequality: Citizenship in the Age of Privatized Communications.” Journal of Communication 39.3 (1991): 180-95. QUT, CIRAC, and Cutler & Co. Research and Innovation Systems in the Production of Digital Content and Applications: Report for the National Office for the Information Economy. Canberra: Commonwealth of Australia, Sept. 2003. Tambini, Damian. Universal Access: A Realistic View. IPPR/Citizens Online Research Publication 1. London: IPPR, 2000. Thomas, Julian and Marion McCutcheon. “Is Broadcasting Special? Charging for Spectrum.” Conference paper. ABA conference, Canberra. May 2003. Turner, Graeme. “Talkback, Advertising and Journalism: A cautionary tale of self-regulated radio”. International Journal of Cultural Studies 3.2 (2000): 247-255. ---. “Reshaping Australian Institutions: Popular Culture, the Market and the Public Sphere.” Culture in Australia: Policies, Publics and Programs. Ed. Tony Bennett and David Carter. Melbourne: Cambridge UP, 2001. Winston, Brian. Media, Technology and Society: A History from the Telegraph to the Internet. London: Routledge, 1998. Web Links http://www.aba.gov.au http://www.aca.gov.au http://www.accc.gov.au http://www.acif.org.au http://www.adma.com.au http://www.ctva.com.au http://www.crtc.gc.ca http://www.dcita.com.au http://www.dfat.gov.au http://www.fcc.gov http://www.ippr.org.uk http://www.ofcom.org.uk http://www.oflc.gov.au Links http://www.commercialalert.org/ Citation reference for this article MLA Style Dwyer, Tim. "Transformations" M/C: A Journal of Media and Culture <http://www.media-culture.org.au/0403/06-transformations.php>. APA Style Dwyer, T. (2004, Mar17). Transformations. M/C: A Journal of Media and Culture, 7, <http://www.media-culture.org.au/0403/06-transformations.php>

Abstract:

'Self-awareness' and the development of the autonomous subject (derived from Enlightenment and the Anglo-European philosophical traditions) has often been implicated in discussions of modernity. In East Asian societies where the Confucianist social order is seen as a deep-rooted social and cultural force, discussions of modernity and modernisation have often revolved around the tension between the spread of individualism and liberalism that come with modernisation and contact with the West. The preservation of traditional sociocultural values and familial and social structures that stress mutual obligations, social harmony and a certain form of "benign" paternalism have been key concerns. The popular television dramas in these societies seem to provide a public imaginary space where such tensions and conflicts are often played out in dramatic ways. They provide places were simulated or compromised solutions are proposed and explored. Popular TV romance dramas in particular can serve as a window to the ways in which the topic of the (non-) self-determining subject is explored. These dramas typically present a scenario in which strong mutual love and desire between two people come into conflict with the existing sociocultural values (e.g., familial, social constraints). In this paper, I analyse a recent popular South Korean TV romance drama: (1) Autumn in My Heart (also known as Endless Love I, Autumn for short below) and contrast it with (2) Friends, another recent popular TV romance drama jointly produced by television companies in Japan and South Korea. These cultural products are shown not only in their respective societies but also sold to television companies in other neighbouring countries; their VCD/DVDs are widely marketed and circulated in East Asian areas (e.g., Hong Kong, Taiwan, Mainland China). 1 Autumn is about a brother (played by Song Seung-hun) and sister (played by Song Hye-kyo) who had grown up together and had developed a very close relationship in a happy middle class family until one day the family found out that the girl was actually not their own. There had been a mistake in the hospital and two baby girls were swapped. Hye-kyo was 14 when this mistake was discovered. She returned to her real mother's poor working class home (her father died from blood cancer before she was born), while the middle class family left Korea for the States with their son and newly recovered daughter as an attempt to forget about the whole incident. From then on, Hye-kyo was separated from her "brother" (Seung-hun) and started her longing for him. Ten years later, the middle class family returned to South Korea and the "brother" and "sister" met again and fell in love. Seung-hun wanted to break his prior engagement with his fiancée to marry Hye-kyo. However, family and friends still saw them as "brother" and "sister" (despite the fact that they are not related in blood) and imposed great familial and social pressure on them to end their "improper" relationship. Later, Hye-kyo discovered that she had blood cancer. She hid her illness from Seung-hun and wished him happiness with his fiancé. Seung-hun, not knowing about Hye-kyo's illness, and under a guilty conscience to make it up to his fiancée (who had attempted suicide for him), consented to leave Hye-kyo and go back to the States with his fiancé. At the last moment, he found out about Hye-kyo's illness and rushed to the hospital. Families and friends were finally moved by their love for each other and did not prevent them from spending their last days together. Hye-kyo died from her illness soon and Seung-hun, having lost all hope and interest in life, was hit by a truck. To the Western audience, such a storyline may seem implausible and perhaps impossible. For instance, how can family and friends find any legitimate reasons to prevent Seung-hun and Hye-kyo from loving each other when they are not blood relatives? Seung-hun's father mentioned once that their "improper relationship" would bring disgrace to the family. His mother did not support their union, either, as she could not bear to see the "brother-sister" relationship being transformed into a romantic, sexual relationship. She became ill, tormented by her own guilty feelings: she blamed herself for not taking Hye-kyo with her to the States ten years ago and she thought that their "love" for each other was a tragic distortion of their original brotherly and sisterly feelings due to their long separation. On the other hand, Seung-hun felt guilty for breaking his prior promise to his fiancé. Hye-kyo was also full of guilty feelings for she felt that they were hurting everybody who cared about them. Almost 90% of the time when the couple talked to each other, they were in tears and were deeply tormented by the conflict between their perceived obligations towards family and friends who loved them and their strong desire to stay together. At one point, they decided to part so that "no one would get hurt any more" (without admitting that they themselves were deeply hurt). Such self-negating actions were coupled with an unquestioning acceptance of the legitimacy of the familial and social demands on them. Is the current South Korean society very much against the development of an autonomous individual and the individual's self-determining actions? On this issue, Korean cultural studies scholar Lee Dong-hoo had the following comments: Many Korean dramas, especially daily soap operas, put values on relationships, such as family relationship and friendship. Even a success story, which emphasizes one's own will to succeed, doesn't neglect the aspect of human relationships. … The traditional Confucianist ethics or patriarchal ideology can be found in the dramas' emphasis on relationship or one's social role. And I think that keeping good relationships is one of the survival strategies in Korea. The Korean society has been maintained by the closely connected social nets. The dramas may (unconsciously) reflect this reality. Lee's remarks about the importance of Confucianism in the Korean society are evidenced in the long-term activities of the well-organised Confucianist society ("Confucian Forest"), which maintains special schools in major cities and counties, offering instruction in Confucianist ethics, rituals and practices (Wu 27). Another example of Confucianist relational ethics can be found in the recent rejection by the South Korean parliament of the nominated female prime minister; one of the reasons quoted is that her son has chosen to be an American citizen (Nan 26). Before moving on to a discussion of the ideological implications of the tragic ending in Autumn, let us first look at another recent popular TV romance drama, Friends, which was jointly produced by Japanese and South Korean television companies. Interestingly, Friends did not start with a scene in Korea or Japan but with the Victorian Harbor scene in Hong Kong, with spectacular cosmopolitan skyscrapers in the background, and a Western-style saxophonist playing Jazz music in a busy street corner. Tomoko, a tourist from Japan, was left on her own by her colleague who had travelled with her on holiday but was keen to see her boyfriend who worked in Hong Kong. Soon, Tomoko was robbed of her handbag in a busy street. In chasing the robber, she mistook Kim as the culprit. After the misunderstanding was cleared up, they became friends. Kim was a college student from South Korea and an active member of the Film society in his university. He was in Hong Kong trying to shoot his first and last movie on a shoestring budget (last because he had decided to give up film-making after this to conform to his father's wish for him to run the family business). Tomoko agreed to help Kim by acting in his movie, which was about a young woman running and searching for true love in the busy streets of a foreign place (Hong Kong). After the short stay in Hong Kong, they returned to Japan and Korea respectively and started their e-mail correspondence. Soon they fell in love. Tomoko felt that corresponding with Kim made her able to like herself again. Coming from a divorced, single-parent family and not doing very well in school, she had tried to commit suicide before. Her lowly, routine job as a sales assistant in a big department store in Tokyo also gave her little satisfaction and purpose in life. However, after starting her romance with Kim, Tomoko seemed to have regained confidence in herself and a purpose in life -- she started taking lessons in the Korean language, worked very hard and finally succeeded in becoming a tour guide for Korean trips so that she could move to South Korea. Likewise, Kim found that he could become himself again when he was with Tomoko. Tomoko encouraged him to pursue his dream of becoming a movie director. However, aggravating family pressure later made Kim wonder whether he was right in defying his father's wishes (by pursuing a film career and loving a Japanese woman) and he blamed Tomoko for his strained relationship with his father. Tomoko, dejected and heart-broken, returned to Japan. Kim, having lost Tomoko, came to his senses and returned to his low-paid job as a film production assistant. Finally he succeeded in gaining a prize for his movie and his parents came to the award ceremony indicating a softening on the part of his father, who finally came to recognise the value of, and his passion for, film work. Kim later became re-united with Tomoko. The happy ending of Friends stands in sharp contrast with the tragic ending of Autumn. The simulated ending of Friends reflects "imaginary realism", one of the newly appropriated strategies based on marketing considerations found in the recent hugely successful blockbuster movies produced in South Korea; it "enables [one] to escape the restrictions of reality without losing a sense of the real" (Lee 12). In Autumn, Hye-kyo frequently said to Seung-hun that their actions would be punished and she later remarked that her illness was a punishment for hurting other people. This tragic ending thus seems to have the ideological, didactic effect of teaching about the punishment for violating the Confucianist social order. Friends, on the other hand, seems to use the hybrid, third space created by the cosmopolitan scene and Western symbols (the Western street musician playing jazz) in Hong Kong (a former British colony which claims itself to be "the Manhattan of Asia") to fabricate a modernised, Westernised and yet still Asian background for the love story to start in. Tomoko was instrumental in inducing Kim to follow his dream, to become the person he really wanted to be. Kim's subsequent success which helped win the acceptance of his father symbolises the possibility of the maturing of the self-determining subject in the new, globalised economic order (Kim's superior in Kim's military service once encouraged him to follow his passion and contribute to the film-making industry to bring glory to the nation) and the possible gradual transition from Confucianism to a certain form of nationalist liberalism in South Korea (e.g., following one's dream and contributing to national glory simultaneously), under the influence of seemingly more Wesernised neighbouring societies (e.g., Japan, Hong Kong). Autumn and Friends seem to represent two different possible stances towards the traditional order at this historical juncture when South Korea is experiencing enormous economic success and going through modernisation and a certain degree of Westernisation that come with its participation in the global economic order. Sociocultural tensions, conflicts and resolutions are simulated and explored in the relatively safe, imaginary space of popular TV dramas, which apart from playing their economic part in a highly successful national media industry, also play an important role in engaging the transnational public (e.g., audiences in East Asian societies which share a Confucianist tradition) with sociocultural issues in an imaginary space. As in the feminist retelling and re-staging of the traditional Chinese opera Butterfly Lovers in newly formed Communist China in the 1950s to explore the self-determining subject and autonomous actions of the female protagonist (Li), these Korean TV dramas seem to provide an important public space for the explorations of a society's cultural ethos and the contested issues of modernity, Westernisation and cosmopolitanisation. They reflect the articulation of different (contradictory) cultural, economic and historical forces and their potential constitutive impact on the future sociocultural landscape of East Asian societies awaits further research. Notes For instance, the media in Hong Kong and China readily talk of the coming of the "Korean Wave" and the names of Korean TV idols such as Song Hye-kyo, Song Seung-hun and Won Bin (who co-starred in Autumn) are familiar to many Chinese young people. The final episode of Autumn aired on Asia Television (ATV) in August 2002 had attracted as high as 70% of that night's television audience in Hong Kong, a rare phenomenon that ATV hurried to boast of. References Lee, Dong-Hoo. "Relationships in Korean Dramas". E-mail communication to the author, 6 August 2002. Lee, Sooyeon. Explaining the South Korean blockbuster movies: An industrial and textual analysis. Unpublished manuscript. Korean Women's Development Institute, South Korea, 2002. Li, Siu Leung. Cross-dressing in Chinese opera. Hong Kong: The University of Hong Kong Press, 2001. Nan, Li Ming. "Broken dream of female prime minister in a sad South Korea [in Chinese]." Yazhou Zhoukan—The International Chinese Newsweekly, 12-18 August 2002: 26. Wu, Le Shan. "Female prime minister in South Korea's new era [in Chinese]." Yazhou Zhoukan—The International Chinese Newsweekly, 22-28 July 2002: 26-27. Citation reference for this article Substitute your date of access for Dn Month Year etc... MLA Style Lin, Angel M. Y.. "Modernity and the Self" M/C: A Journal of Media and Culture 5.5 (2002). [your date of access] < http://www.media-culture.org.au/mc/0210/Lin.html &gt. Chicago Style Lin, Angel M. Y., "Modernity and the Self" M/C: A Journal of Media and Culture 5, no. 5 (2002), < http://www.media-culture.org.au/mc/0210/Lin.html &gt ([your date of access]). APA Style Lin, Angel M. Y.. (2002) Modernity and the Self. M/C: A Journal of Media and Culture 5(5). < http://www.media-culture.org.au/mc/0210/Lin.html &gt ([your date of access]).

Abstract:

Introduction I am a transmigrant who has moved back and forth between the West and the Rest. I was born and raised in a Muslim family in a predominantly Muslim country, Bangladesh, but I spent several years of my childhood in Pakistan. After my marriage, I lived in the United States for a year and a half, the Middle East for 5 years, Australia for three years, back to the Middle East for another 5 years, then, finally, in Australia for the last 12 years. I speak Bengali (my mother tongue), Urdu (which I learnt in Pakistan), a bit of Arabic (learnt in the Middle East); but English has always been my medium of instruction. So where is home? Is it my place of origin, the Muslim umma, or my land of settlement? Or is it my ‘root’ or my ‘route’ (Blunt and Dowling)? Blunt and Dowling (199) observe that the lives of transmigrants are often interpreted in terms of their ‘roots’ and ‘routes’, which are two frameworks for thinking about home, homeland and diaspora. Whereas ‘roots’ might imply an original homeland from which people have scattered, and to which they might seek to return, ‘routes’ focuses on mobile, multiple and transcultural geographies of home. However, both ‘roots’ and ‘routes’ are attached to emotion and identity, and both invoke a sense of place, belonging or alienation that is intrinsically tied to a sense of self (Blunt and Dowling 196-219). In this paper, I equate home with my root (place of birth) and route (transnational homing) within the context of the ‘diaspora and belonging’. First I define the diaspora and possible criteria of belonging. Next I describe my transnational homing within the framework of diaspora and belonging. Finally, I consider how Australia can be a ‘home’ for me and other Muslim Australians. The Diaspora and Belonging Blunt and Dowling (199) define diaspora as “scattering of people over space and transnational connections between people and the places”. Cohen emphasised the ethno-cultural aspects of the diaspora setting; that is, how migrants identify and position themselves in other nations in terms of their (different) ethnic and cultural orientation. Hall argues that the diasporic subjects form a cultural identity through transformation and difference. Speaking of the Hindu diaspora in the UK and Caribbean, Vertovec (21-23) contends that the migrants’ contact with their original ‘home’ or diaspora depends on four factors: migration processes and factors of settlement, cultural composition, structural and political power, and community development. With regard to the first factor, migration processes and factors of settlement, Vertovec explains that if the migrants are political or economic refugees, or on a temporary visa, they are likely to live in a ‘myth of return’. In the cultural composition context, Vertovec argues that religion, language, region of origin, caste, and degree of cultural hom*ogenisation are factors in which migrants are bound to their homeland. Concerning the social structure and political power issue, Vertovec suggests that the extent and nature of racial and ethnic pluralism or social stigma, class composition, degree of institutionalised racism, involvement in party politics (or active citizenship) determine migrants’ connection to their new or old home. Finally, community development, including membership in organisations (political, union, religious, cultural, leisure), leadership qualities, and ethnic convergence or conflict (trends towards intra-communal or inter-ethnic/inter-religious co-operation) would also affect the migrants’ sense of belonging. Using these scholarly ideas as triggers, I will examine my home and belonging over the last few decades. My Home In an initial stage of my transmigrant history, my home was my root (place of birth, Dhaka, Bangladesh). Subsequently, my routes (settlement in different countries) reshaped my homes. In all respects, the ethno-cultural factors have played a big part in my definition of ‘home’. But on some occasions my ethnic identification has been overridden by my religious identification and vice versa. By ethnic identity, I mean my language (mother tongue) and my connection to my people (Bangladeshi). By my religious identity, I mean my Muslim religion, and my spiritual connection to the umma, a Muslim nation transcending all boundaries. Umma refers to the Muslim identity and unity within a larger Muslim group across national boundaries. The only thing the members of the umma have in common is their Islamic belief (Spencer and Wollman 169-170). In my childhood my father, a banker, was relocated to Karachi, Pakistan (then West Pakistan). Although I lived in Pakistan for much of my childhood, I have never considered it to be my home, even though it is predominantly a Muslim country. In this case, my home was my root (Bangladesh) where my grandparents and extended family lived. Every year I used to visit my grandparents who resided in a small town in Bangladesh (then East Pakistan). Thus my connection with my home was sustained through my extended family, ethnic traditions, language (Bengali/Bangla), and the occasional visits to the landscape of Bangladesh. Smith (9-11) notes that people build their connection or identity to their homeland through their historic land, common historical memories, myths, symbols and traditions. Though Pakistan and Bangladesh had common histories, their traditions of language, dress and ethnic culture were very different. For example, the celebration of the Bengali New Year (Pohela Baishakh), folk dance, folk music and folk tales, drama, poetry, lyrics of poets Rabindranath Tagore (Rabindra Sangeet) and Nazrul Islam (Nazrul Geeti) are distinct in the cultural heritage of Bangladesh. Special musical instruments such as the banshi (a bamboo flute), dhol (drums), ektara (a single-stringed instrument) and dotara (a four-stringed instrument) are unique to Bangladeshi culture. The Bangladeshi cuisine (rice and freshwater fish) is also different from Pakistan where people mainly eat flat round bread (roti) and meat (gosh). However, my bonding factor to Bangladesh was my relatives, particularly my grandparents as they made me feel one of ‘us’. Their affection for me was irreplaceable. The train journey from Dhaka (capital city) to their town, Noakhali, was captivating. The hustle and bustle at the train station and the lush green paddy fields along the train journey reminded me that this was my ‘home’. Though I spoke the official language (Urdu) in Pakistan and had a few Pakistani friends in Karachi, they could never replace my feelings for my friends, extended relatives and cousins who lived in Bangladesh. I could not relate to the landscape or dry weather of Pakistan. More importantly, some Pakistani women (our neighbours) were critical of my mother’s traditional dress (saree), and described it as revealing because it showed a bit of her back. They took pride in their traditional dress (shalwar, kameez, dopatta), which they considered to be more covered and ‘Islamic’. So, because of our traditional dress (saree) and perhaps other differences, we were regarded as the ‘Other’. In 1970 my father was relocated back to Dhaka, Bangladesh, and I was glad to go home. It should be noted that both Pakistan and Bangladesh were separated from India in 1947 – first as one nation; then, in 1971, Bangladesh became independent from Pakistan. The conflict between Bangladesh (then East Pakistan) and Pakistan (then West Pakistan) originated for economic and political reasons. At this time I was a high school student and witnessed acts of genocide committed by the Pakistani regime against the Bangladeshis (March-December 1971). My memories of these acts are vivid and still very painful. After my marriage, I moved from Bangladesh to the United States. In this instance, my new route (Austin, Texas, USA), as it happened, did not become my home. Here the ethno-cultural and Islamic cultural factors took precedence. I spoke the English language, made some American friends, and studied history at the University of Texas. I appreciated the warm friendship extended to me in the US, but experienced a degree of culture shock. I did not appreciate the pub life, alcohol consumption, and what I perceived to be the lack of family bonds (children moving out at the age of 18, families only meeting occasionally on birthdays and Christmas). Furthermore, I could not relate to de facto relationships and acceptance of sex before marriage. However, to me ‘home’ meant a family orientation and living in close contact with family. Besides the cultural divide, my husband and I were living in the US on student visas and, as Vertovec (21-23) noted, temporary visa status can deter people from their sense of belonging to the host country. In retrospect I can see that we lived in the ‘myth of return’. However, our next move for a better life was not to our root (Bangladesh), but another route to the Muslim world of Dhahran in Saudi Arabia. My husband moved to Dhahran not because it was a Muslim world but because it gave him better economic opportunities. However, I thought this new destination would become my home – the home that was coined by Anderson as the imagined nation, or my Muslim umma. Anderson argues that the imagined communities are “to be distinguished, not by their falsity/genuineness, but by the style in which they are imagined” (6; Wood 61). Hall (122) asserts: identity is actually formed through unconscious processes over time, rather than being innate in consciousness at birth. There is always something ‘imaginary’ or fantasized about its unity. It always remains incomplete, is always ‘in process’, always ‘being formed’. As discussed above, when I had returned home to Bangladesh from Pakistan – both Muslim countries – my primary connection to my home country was my ethnic identity, language and traditions. My ethnic identity overshadowed the religious identity. But when I moved to Saudi Arabia, where my ethnic identity differed from that of the mainstream Arabs and Bedouin/nomadic Arabs, my connection to this new land was through my Islamic cultural and religious identity. Admittedly, this connection to the umma was more psychological than physical, but I was now in close proximity to Mecca, and to my home of Dhaka, Bangladesh. Mecca is an important city in Saudi Arabia for Muslims because it is the holy city of Islam, the home to the Ka’aba (the religious centre of Islam), and the birthplace of Prophet Muhammad [Peace Be Upon Him]. It is also the destination of the Hajj, one of the five pillars of Islamic faith. Therefore, Mecca is home to significant events in Islamic history, as well as being an important present day centre for the Islamic faith. We lived in Dhahran, Saudi Arabia for 5 years. Though it was a 2.5 hours flight away, I treasured Mecca’s proximity and regarded Dhahran as my second and spiritual home. Saudi Arabia had a restricted lifestyle for women, but I liked it because it was a Muslim country that gave me the opportunity to perform umrah Hajj (pilgrimage). However, Saudi Arabia did not allow citizenship to expatriates. Saudi Arabia’s government was keen to protect the status quo and did not want to compromise its cultural values or standard of living by allowing foreigners to become a permanent part of society. In exceptional circ*mstances only, the King granted citizenship to a foreigner for outstanding service to the state over a number of years. Children of foreigners born in Saudi Arabia did not have rights of local citizenship; they automatically assumed the nationality of their parents. If it was available, Saudi citizenship would assure expatriates a secure and permanent living in Saudi Arabia; as it was, there was a fear among the non-Saudis that they would have to leave the country once their job contract expired. Under the circ*mstances, though my spiritual connection to Mecca was strong, my husband was convinced that Saudi Arabia did not provide any job security. So, in 1987 when Australia offered migration to highly skilled people, my husband decided to migrate to Australia for a better and more secure economic life. I agreed to his decision, but quite reluctantly because we were again moving to a non-Muslim part of the world, which would be culturally different and far away from my original homeland (Bangladesh). In Australia, we lived first in Brisbane, then Adelaide, and after three years we took our Australian citizenship. At that stage I loved the Barossa Valley and Victor Harbour in South Australia, and the Gold Coast and Sunshine Coast in Queensland, but did not feel at home in Australia. We bought a house in Adelaide and I was a full time home-maker but was always apprehensive that my children (two boys) would lose their culture in this non-Muslim world. In 1990 we once again moved back to the Muslim world, this time to Muscat, Sultanate of Oman. My connection to this route was again spiritual. I valued the fact that we would live in a Muslim country and our children would be brought up in a Muslim environment. But my husband’s move was purely financial as he got a lucrative job offer in Muscat. We had another son in Oman. We enjoyed the luxurious lifestyle provided by my husband’s workplace and the service provided by the housemaid. I loved the beaches and freedom to drive my car, and I appreciated the friendly Omani people. I also enjoyed our frequent trips (4 hours flight) to my root, Dhaka, Bangladesh. So our children were raised within our ethnic and Islamic culture, remained close to my root (family in Dhaka), though they attended a British school in Muscat. But by the time I started considering Oman to be my second home, we had to leave once again for a place that could provide us with a more secure future. Oman was like Saudi Arabia; it employed expatriates only on a contract basis, and did not give them citizenship (not even fellow Muslims). So after 5 years it was time to move back to Australia. It was with great reluctance that I moved with my husband to Brisbane in 1995 because once again we were to face a different cultural context. As mentioned earlier, we lived in Brisbane in the late 1980s; I liked the weather, the landscape, but did not consider it home for cultural reasons. Our boys started attending expensive private schools and we bought a house in a prestigious Western suburb in Brisbane. Soon after arriving I started my tertiary education at the University of Queensland, and finished an MA in Historical Studies in Indian History in 1998. Still Australia was not my home. I kept thinking that we would return to my previous routes or the ‘imagined’ homeland somewhere in the Middle East, in close proximity to my root (Bangladesh), where we could remain economically secure in a Muslim country. But gradually I began to feel that Australia was becoming my ‘home’. I had gradually become involved in professional and community activities (with university colleagues, the Bangladeshi community and Muslim women’s organisations), and in retrospect I could see that this was an early stage of my ‘self-actualisation’ (Maslow). Through my involvement with diverse people, I felt emotionally connected with the concerns, hopes and dreams of my Muslim-Australian friends. Subsequently, I also felt connected with my mainstream Australian friends whose emotions and fears (9/11 incident, Bali bombing and 7/7 tragedy) were similar to mine. In late 1998 I started my PhD studies on the immigration history of Australia, with a particular focus on the historical settlement of Muslims in Australia. This entailed retrieving archival files and interviewing people, mostly Muslims and some mainstream Australians, and enquiring into relevant migration issues. I also became more active in community issues, and was not constrained by my circ*mstances. By circ*mstances, I mean that even though I belonged to a patriarchally structured Muslim family, where my husband was the main breadwinner, main decision-maker, my independence and research activities (entailing frequent interstate trips for data collection, and public speaking) were not frowned upon or forbidden (Khan 14-15); fortunately, my husband appreciated my passion for research and gave me his trust and support. This, along with the Muslim community’s support (interviews), and the wider community’s recognition (for example, the publication of my letters in Australian newspapers, interviews on radio and television) enabled me to develop my self-esteem and built up my bicultural identity as a Muslim in a predominantly Christian country and as a Bangladeshi-Australian. In 2005, for the sake of a better job opportunity, my husband moved to the UK, but this time I asserted that I would not move again. I felt that here in Australia (now in Perth) I had a job, an identity and a home. This time my husband was able to secure a good job back in Australia and was only away for a year. I no longer dream of finding a home in the Middle East. Through my bicultural identity here in Australia I feel connected to the wider community and to the Muslim umma. However, my attachment to the umma has become ambivalent. I feel proud of my Australian-Muslim identity but I am concerned about the jihadi ideology of militant Muslims. By jihadi ideology, I mean the extremist ideology of the al-Qaeda terrorist group (Farrar 2007). The Muslim umma now incorporates both moderate and radical Muslims. The radical Muslims (though only a tiny minority of 1.4 billion Muslims worldwide) pose a threat to their moderate counterparts as well as to non-Muslims. In the UK, some second- and third-generation Muslims identify themselves with the umma rather than their parents’ homelands or their country of birth (Husain). It should not be a matter of concern if these young Muslims adopt a ‘pure’ Muslim identity, providing at the same time they are loyal to their country of residence. But when they resort to terrorism with their ‘pure’ Muslim identity (e.g., the 7/7 London bombers) they defame my religion Islam, and undermine my spiritual connection to the umma. As a 1st generation immigrant, the defining criteria of my ‘homeliness’ in Australia are my ethno-cultural and religious identity (which includes my family), my active citizenship, and my community development/contribution through my research work – all of which allow me a sense of efficacy in my life. My ethnic and religious identities generally co-exist equally, but when I see some Muslims kill my fellow Australians (such as the Bali bombings in 2002 and 2005) my Australian identity takes precedence. I feel for the victims and condemn the perpetrators. On the other hand, when I see politics play a role over the human rights issues (e.g., the Tampa incident), my religious identity begs me to comment on it (see Kabir, Muslims in Australia 295-305). Problematising ‘Home’ for Muslim Australians In the European context, Grillo (863) and Werbner (904), and in the Australian context, Kabir (Muslims in Australia) and Poynting and Mason, have identified the diversity within Islam (national, ethnic, religious etc). Werbner (904) notes that in spite of the “wishful talk of the emergence of a ‘British Islam’, even today there are Pakistani, Bangladeshi and Arab mosques, as well as Turkish and Shia’a mosques”; thus British Muslims retain their separate identities. Similarly, in Australia, the existence of separate mosques for the Bangladeshi, Pakistani, Arab and Shia’a peoples indicates that Australian Muslims have also kept their ethnic identities discrete (Saeed 64-77). However, in times of crisis, such as the Salman Rushdie affair in 1989, and the 1990-1991 Gulf crises, both British and Australian Muslims were quick to unite and express their Islamic identity by way of resistance (Kabir, Muslims in Australia 160-162; Poynting and Mason 68-70). In both British and Australian contexts, I argue that a peaceful rally or resistance is indicative of active citizenship of Muslims as it reveals their sense of belonging (also Werbner 905). So when a transmigrant Muslim wants to make a peaceful demonstration, the Western world should be encouraged, not threatened – as long as the transmigrant’s allegiances lie also with the host country. In the European context, Grillo (868) writes: when I asked Mehmet if he was planning to stay in Germany he answered without hesitation: ‘Yes, of course’. And then, after a little break, he added ‘as long as we can live here as Muslims’. In this context, I support Mehmet’s desire to live as a Muslim in a non-Muslim world as long as this is peaceful. Paradoxically, living a Muslim life through ijtihad can be either socially progressive or destructive. The Canadian Muslim feminist Irshad Manji relies on ijtihad, but so does Osama bin Laden! Manji emphasises that ijtihad can be, on the one hand, the adaptation of Islam using independent reasoning, hybridity and the contesting of ‘traditional’ family values (c.f. Doogue and Kirkwood 275-276, 314); and, on the other, ijtihad can take the form of conservative, patriarchal and militant Islamic values. The al-Qaeda terrorist Osama bin Laden espouses the jihadi ideology of Sayyid Qutb (1906-1966), an Egyptian who early in his career might have been described as a Muslim modernist who believed that Islam and Western secular ideals could be reconciled. But he discarded that idea after going to the US in 1948-50; there he was treated as ‘different’ and that treatment turned him against the West. He came back to Egypt and embraced a much more rigid and militaristic form of Islam (Esposito 136). Other scholars, such as Cesari, have identified a third orientation – a ‘secularised Islam’, which stresses general beliefs in the values of Islam and an Islamic identity, without too much concern for practices. Grillo (871) observed Islam in the West emphasised diversity. He stressed that, “some [Muslims were] more quietest, some more secular, some more clamorous, some more negotiatory”, while some were exclusively characterised by Islamic identity, such as wearing the burqa (elaborate veils), hijabs (headscarves), beards by men and total abstinence from drinking alcohol. So Mehmet, cited above, could be living a Muslim life within the spectrum of these possibilities, ranging from an integrating mode to a strict, militant Muslim manner. In the UK context, Zubaida (96) contends that marginalised, culturally-impoverished youth are the people for whom radical, militant Islamism may have an appeal, though it must be noted that the 7/7 bombers belonged to affluent families (O’Sullivan 14; Husain). In Australia, Muslim Australians are facing three challenges. First, the Muslim unemployment rate: it was three times higher than the national total in 1996 and 2001 (Kabir, Muslims in Australia 266-278; Kabir, “What Does It Mean” 63). Second, some spiritual leaders have used extreme rhetoric to appeal to marginalised youth; in January 2007, the Australian-born imam of Lebanese background, Sheikh Feiz Mohammad, was alleged to have employed a DVD format to urge children to kill the enemies of Islam and to have praised martyrs with a violent interpretation of jihad (Chulov 2). Third, the proposed citizenship test has the potential to make new migrants’ – particularly Muslims’ – settlement in Australia stressful (Kabir, “What Does It Mean” 62-79); in May 2007, fuelled by perceptions that some migrants – especially Muslims – were not integrating quickly enough, the Howard government introduced a citizenship test bill that proposes to test applicants on their English language skills and knowledge of Australian history and ‘values’. I contend that being able to demonstrate knowledge of history and having English language skills is no guarantee that a migrant will be a good citizen. Through my transmigrant history, I have learnt that developing a bond with a new place takes time, acceptance and a gradual change of identity, which are less likely to happen when facing assimilationist constraints. I spoke English and studied history in the United States, but I did not consider it my home. I did not speak the Arabic language, and did not study Middle Eastern history while I was in the Middle East, but I felt connected to it for cultural and religious reasons. Through my knowledge of history and English language proficiency I did not make Australia my home when I first migrated to Australia. Australia became my home when I started interacting with other Australians, which was made possible by having the time at my disposal and by fortunate circ*mstances, which included a fairly high level of efficacy and affluence. If I had been rejected because of my lack of knowledge of ‘Australian values’, or had encountered discrimination in the job market, I would have been much less willing to embrace my host country and call it home. I believe a stringent citizenship test is more likely to alienate would-be citizens than to induce their adoption of values and loyalty to their new home. Conclusion Blunt (5) observes that current studies of home often investigate mobile geographies of dwelling and how it shapes one’s identity and belonging. Such geographies of home negotiate from the domestic to the global context, thus mobilising the home beyond a fixed, bounded and confining location. Similarly, in this paper I have discussed how my mobile geography, from the domestic (root) to global (route), has shaped my identity. Though I received a degree of culture shock in the United States, loved the Middle East, and was at first quite resistant to the idea of making Australia my second home, the confidence I acquired in residing in these ‘several homes’ were cumulative and eventually enabled me to regard Australia as my ‘home’. I loved the Middle East, but I did not pursue an active involvement with the Arab community because I was a busy mother. Also I lacked the communication skill (fluency in Arabic) with the local residents who lived outside the expatriates’ campus. I am no longer a cultural freak. I am no longer the same Bangladeshi woman who saw her ethnic and Islamic culture as superior to all other cultures. I have learnt to appreciate Australian values, such as tolerance, ‘a fair go’ and multiculturalism (see Kabir, “What Does It Mean” 62-79). My bicultural identity is my strength. With my ethnic and religious identity, I can relate to the concerns of the Muslim community and other Australian ethnic and religious minorities. And with my Australian identity I have developed ‘a voice’ to pursue active citizenship. Thus my biculturalism has enabled me to retain and merge my former home with my present and permanent home of Australia. References Anderson, Benedict. Imagined Communities: Reflections on the Origin and Spread of Nationalism. London, New York: Verso, 1983. Australian Bureau of Statistics: Census of Housing and Population, 1996 and 2001. Blunt, Alison. Domicile and Diaspora: Anglo-Indian Women and the Spatial Politics of Home. Oxford: Blackwell, 2005. Blunt, Alison, and Robyn Dowling. Home. London and New York: Routledge, 2006. Cesari, Jocelyne. “Muslim Minorities in Europe: The Silent Revolution.” In John L. Esposito and Burgat, eds., Modernising Islam: Religion in the Public Sphere in Europe and the Middle East. London: Hurst, 2003. 251-269. Chulov, Martin. “Treatment Has Sheik Wary of Returning Home.” Weekend Australian 6-7 Jan. 2007: 2. Cohen, Robin. Global Diasporas: An Introduction. Seattle: University of Washington, 1997. Doogue, Geraldine, and Peter Kirkwood. Tomorrow’s Islam: Uniting Old-Age Beliefs and a Modern World. Sydney: ABC Books, 2005. Esposito, John. The Islamic Threat: Myth or Reality? 3rd ed. New York, Oxford: Oxford UP, 1999. Farrar, Max. “When the Bombs Go Off: Rethinking and Managing Diversity Strategies in Leeds, UK.” International Journal of Diversity in Organisations, Communities and Nations 6.5 (2007): 63-68. Grillo, Ralph. “Islam and Transnationalism.” Journal of Ethnic and Migration Studies 30.5 (Sep. 2004): 861-878. Hall, Stuart. Polity Reader in Cultural Theory. Cambridge: Polity Press, 1994. Huntington, Samuel, P. The Clash of Civilisation and the Remaking of World Order. London: Touchstone, 1998. Husain, Ed. The Islamist: Why I Joined Radical Islam in Britain, What I Saw inside and Why I Left. London: Penguin, 2007. Kabir, Nahid. Muslims in Australia: Immigration, Race Relations and Cultural History. London: Kegan Paul, 2005. ———. “What Does It Mean to Be Un-Australian: Views of Australian Muslim Students in 2006.” People and Place 15.1 (2007): 62-79. Khan, Shahnaz. Aversion and Desire: Negotiating Muslim Female Identity in the Diaspora. Toronto: Women’s Press, 2002. Manji, Irshad. The Trouble with Islam Today. Canada:Vintage, 2005. Maslow, Abraham. Motivation and Personality. New York: Harper, 1954. O’Sullivan, J. “The Real British Disease.” Quadrant (Jan.-Feb. 2006): 14-20. Poynting, Scott, and Victoria Mason. “The Resistible Rise of Islamophobia: Anti-Muslim Racism in the UK and Australia before 11 September 2001.” Journal of Sociology 43.1 (2007): 61-86. Saeed, Abdallah. Islam in Australia. Sydney: Allen and Unwin, 2003. Smith, Anthony D. National Identity. Harmondsworth: Penguin, 1991. Spencer, Philip, and Howard Wollman. Nationalism: A Critical Introduction. London: Sage, 2002. Vertovec, Stevens. The Hindu Diaspora: Comparative Patterns. London: Routledge. 2000. Werbner, Pnina, “Theorising Complex Diasporas: Purity and Hybridity in the South Asian Public Sphere in Britain.” Journal of Ethnic and Migration Studies 30.5 (2004): 895-911. Wood, Dennis. “The Diaspora, Community and the Vagrant Space.” In Cynthia Vanden Driesen and Ralph Crane, eds., Diaspora: The Australasian Experience. New Delhi: Prestige, 2005. 59-64. Zubaida, Sami. “Islam in Europe: Unity or Diversity.” Critical Quarterly 45.1-2 (2003): 88-98. Citation reference for this article MLA Style Kabir, Nahid. "Why I Call Australia ‘Home’?: A Transmigrant’s Perspective." M/C Journal 10.4 (2007). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0708/15-kabir.php>. APA Style Kabir, N. (Aug. 2007) "Why I Call Australia ‘Home’?: A Transmigrant’s Perspective," M/C Journal, 10(4). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0708/15-kabir.php>.

Abstract:

One of the first challenges faced by new Australian Prime Minister, Kevin Rudd, was what to do with the former government’s controversial citizenship test. While a quick evaluation of the test shows that 93 percent of those who have sat it ‘passed’ (Hoare), most media controversy has focussed less on the validity of such a test than whether questions relating to Australian cricketing legend, Don Bradman, are appropriate (Hawley). While the citizenship test seems nothing more that a crude and populist measure imposed by the former Howard government in its ongoing nationalistic agenda, which included paying schools to raise the Australian flag (“PM Unfurls Flag”), its imposition seems a timely reminder of the challenge of understanding citizenship today. For as the demographic structures around us continue to change, so must our understandings of ‘citizenship’. More importantly, this fluid understanding of citizenship is not limited to academics, and policy-makers, but new technologies, the processes of globalisation including a globalised media, changing demographic patterns including migration, as well as environmental challenges that place pressure on limited resources is altering the citizens understanding of their own role as well as those around them. This paper aims to sketch out a proposed new research agenda that seeks to investigate this fluid and heterogenous nature of citizenship. The focus of the research has so far been Sydney and is enveloped by a broader aim of promoting an increased level of citizen engagement both within formal and informal political structures. I begin by sketching the complex nature of Sydney before presenting some initial research findings. Sydney – A Complex City The so-called ‘emerald city’ of Sydney has been described in many ways: from a ‘global’ city (fa*gan, Dowling and Longdale 1) to an ‘angry’ city (Price 16). Sarah Price’s investigative article included research from the University of Western Sydney’s Centre of Culture Research, the Bureau of Crime Statistics and interviews with Tony Grabs, the director of trauma at St Vincent’s Hospital in inner city Darlinghurst. Price found that both injuries from alcohol and drug-related violence had risen dramatically over the last few years and seemed to be driven by increasing frustrations of a city that is perceived to be lacking appropriate infrastructure and rising levels of personal and household debt. Sydney’s famous harbour and postcard landmarks are surrounded by places of controversy and poverty, with residents of very backgrounds living in close proximity: often harmoniously and sometimes less so. According to recent research by Griffith University’s Urban Research Program, the city is becoming increasingly polarised, with the wealthiest enjoying high levels of access to amenities while other sections of the population experiencing increasing deprivation (Frew 7). Sydney is often segmented into different regions: the growth corridors of the western suburbs which include the ‘Aspirational class’; the affluent eastern suburb; the southern beachside suburbs surrounding Cronulla affectionately known by local residents as ‘the Shire’, and so on. This, however, hides that fact that these areas are themselves complex and heterogenous in character (Frew 7). As a result, the many clichés associated with such segments lead to an over simplification of regional characteristics. The ‘growth corridors’ of Western Sydney, for example, have, in recent times, become a focal point of political and social commentary. From the rise of the ‘Aspirational’ voter (Anderson), seen to be a key ‘powerbroker’ in federal and state politics, to growing levels of disenfranchised young people, this region is multifaceted and should not be simplified. These areas often see large-scale, private housing estates; what Brendan Gleeson describes as ‘privatopias’, situated next to rising levels of homelessness (“What’s Driving”): a powerful and concerning image that should not escape our attention. (Chamberlain and Mackenzie pay due attention to the issue in Homeless Careers.) It is also home to a growing immigrant population who often arrive as business migrants and as well as a rising refugee population traumatised by war and displacement (Collins 1). These growth corridors then, seem to simultaneously capture both the ambitions and the fears of Sydney. That is, they are seen as both areas of potential economic boom as well as social stress and potential conflict (Gleeson 89). One way to comprehend the complexity associated with such diversity and change is to reflect on the proximity of the twin suburbs of Macquarie Links and Macquarie Fields situated in Sydney’s south-western suburbs. Separated by the clichéd ‘railway tracks’, one is home to the growing Aspirational class while the other continues to be plagued by the stigma of being, what David Burchell describes as, a ‘dysfunctional dumping ground’ whose plight became national headlines during the riots in 2005. The riots were sparked after a police chase involving a stolen car led to a crash and the death of a 17 year-old and 19 year-old passengers. Residents blamed police for the deaths and the subsequent riots lasted for four nights – involving 150 teenagers clashing with New South Wales Police. The dysfunction, Burchell notes is seen in crime statistics that include 114 stolen cars, 227 burglaries, 457 cases of property damage and 279 assaults – all in 2005 alone. Interestingly, both these populations are surrounded by exclusionary boundaries: one because of the financial demands to enter the ‘Links’ estate, and the other because of the self-imposed exclusion. Such disparities not only provide challenges for policy makers generally, but also have important implications on the attitudes that citizens’ experience towards their relationship with each other as well as the civic institutions that are meant to represent them. This is particular the case if civic institutions are seen to either neglect or favour certain groups. This, in part, has given rise to what I describe here as a ‘citizenship surplus’ as well as a ‘citizenship deficit’. Research Agenda: Investigating Citizenship Surpluses and Deficits This changing city has meant that there has also been a change in the way that different groups interact with, and perceive, civic bodies. As noted, my initial research shows that this has led to the emergence of both citizenship surpluses and deficits. Though the concept of a ‘citizen deficits and surpluses’ have not emerged within the broader literature, there is a wide range of literature that discusses how some sections of the population lack of access to democratic processes. There are three broad areas of research that have emerged relevant here: citizenship and young people (see Arvanitakis; Dee); citizenship and globalisation (see Della Porta; Pusey); and citizenship and immigration (see Baldassar et al.; Gow). While a discussion of each of these research areas is beyond the scope of this paper, a regular theme is the emergence of a ‘democratic deficit’ (Chari et al. 422). Dee, for example, looks at how there exist unequal relationships between local and central governments, young people, communities and property developers in relation to space. Dee argues that this shapes social policy in a range of settings and contexts including their relationship with broader civic institutions and understandings of citizenship. Dee finds that claims for land use that involve young people rarely succeed and there is limited, if any, recourse to civic institutions. As such, we see a democratic deficit emerge because the various civic institutions involved fail in meeting their obligations to citizens. In addition, a great deal of work has emerged that investigates attempts to re-engage citizens through mechanisms to promote citizenship education and a more active citizenship which has also been accompanied by government programs with the same goals (See for example the Western Australian government’s ‘Citizenscape’ program ). For example Hahn (231) undertakes a comparative study of civic education in six countries (including Australia) and the policies and practices with respect to citizenship education and how to promote citizen activism. The results are positive, though the research was undertaken before the tumultuous events of the terrorist attacks in New York, the emergence of the ‘war on terror’ and the rise of ‘Muslim-phobia’. A gap rises, however, within the Australian literature when we consider both the fluid and heterogenous nature of citizenship. That is, how do we understand the relationship between these diverse groups living within such proximity to each other overlayed by changing migration patterns, ongoing globalised processes and changing political environments as well as their relations to civic institutions? Further, how does this influence the way individuals perceive their rights, expectations and responsibilities to the state? Given this, I believe that there is a need to understand citizenship as a fluid and heterogenous phenomenon that can be in surplus, deficit, progressive and reactionary. When discussing citizenship I am interested in how people perceive both their rights and responsibilities to civic institutions as well as to the residents around them. A second, obviously related, area of interest is ‘civic engagement’: that is, “the activities of people in the various organisations and associations that make up what scholars call ‘civil society’” (Portney and Leary 4). Before describing these categories in more detail, I would like to briefly outline the methodological processes employed thus far. Much of the research to this point is based on a combination of established literature, my informal discussions with citizen groups and my observations as ‘an activist.’ That is, over the last few years I have worked with a broad cross section of community-based organisations as well as specific individuals that have attempted to confront perceived injustices. I have undertaken this work as both an activist – with organisations such as Aid/Watch and Oxfam Australia – as well as an academic invited to share my research. This work has involved designing and implementing policy and advocacy strategies including media and public education programs. All interactions begin with a detailed discussion of the aims, resources, abilities and knowledge of the groups involved, followed by workshopping campaigning strategies. This has led to the publication of an ‘activist handbook’ titled ‘From Sitting on the Couch to Changing the World’, which is used to both draft the campaign aims as well as design a systematic strategy. (The booklet, which is currently being re-drafted, is published by Oxfam Australia and registered under a creative commons licence. For those interested, copies are available by emailing j.arvanitakis (at) uws.edu.au.) Much research is also sourced from direct feedback given by participants in reviewing the workshops and strategies The aim of tis paper then, is to sketch out the initial findings as well as an agenda for more formalised research. The initial findings have identified the heterogenous nature of citizenship that I have separated into four ‘citizenship spaces.’ The term space is used because these are not stable groupings as many quickly move between the areas identified as both the structures and personal situations change. 1. Marginalisation and Citizenship Deficit The first category is a citizenship deficit brought on by a sense of marginalisation. This is determined by a belief that it is pointless to interact with civic institutions, as the result is always the same: people’s opinions and needs will be ignored. Or in the case of residents from areas such as Macquarie Fields, the relationship with civic institutions, including police, is antagonistic and best avoided (White par. 21). This means that there is no connection between the population and the civic institutions around them – there is no loyalty or belief that efforts to be involved in political and civic processes will be rewarded. Here groups sense that they do not have access to political avenues to be heard, represented or demand change. This is leading to an experience of disconnection from political processes. The result is both a sense of disengagement and disempowerment. One example here emerged in discussions with protesters around the proposed development of the former Australian Defence Industry (ADI) site in St Marys, an outer-western suburb of Sydney. The development, which was largely approved, was for a large-scale housing estate proposed on sensitive bushlands in a locality that resident’s note is under-serviced in terms of public space. (For details of these discussions, see http://www.adisite.org/.) Residents often took the attitude that whatever the desire of the local community, the development would go ahead regardless. Those who worked at information booths during the resident protests informed me that the attitude was one best summarised by: “Why bother, we always get stuffed around any way.” This was confirmed by my own discussions with local residents – even those who joined the resident action group. 2. Privatisation and Citizenship Deficit This citizenship deficit not only applies to the marginalised, however, for there are also much wealthier populations who also appear to experience a deficit that results from a lack of access to civic institutions. This tends to leads to a privatisation of decision-making and withdrawal from the public arena as well as democratic processes. Consequently, the residents in the pockets of wealth may not be acting as citizens but more like consumers – asserting themselves in terms of Castells’s ‘collective consumption’ (par. 25). This citizenship deficit is brought on by ongoing privatisation. That is, there is a belief that civic institutions (including government bodies) are unable or at least unwilling to service the local community. As a result there is a tendency to turn to private suppliers and believe that individualisation is the best way to manage the community. The result is that citizens feel no connection to the civic institutions around them, not because there is no desire, but there are no services. This group of citizens has often been described as the ‘Aspirationals’ and are most often found in the growth corridors of Sydney. There is no reason to believe that this group is this way because of choice – but rather a failure by government authorities to service their needs. This is confirmed by research undertaken as early as 1990 which found that the residents now labelled Aspirational, were demanding access to public infrastructure services including public schools, but have been neglected by different levels of government. (This was clearly stated by NSW Labor MP for Liverpool, Paul Lynch, who argued for such services as a way to ensure a functioning community particularly for Western Sydney; NSWPD 2001.) As a result there is a reliance on private schools, neighbourhoods, transport and so on. Any ‘why bother’ attitude is thus driven by a lack of evidence that civic institutions can or are not willing to meet their needs. There is a strong sense of local community – but this localisation limited to others in the same geographical location and similar lifestyle. 3. Citizenship Surplus – Empowered Not Engaged The third space of citizenship is based on a ‘surplus’ even if there is limited or no political engagement. This group has quite a lot in common with the ‘Aspirationals’ but may come from areas that are higher serviced by civic institutions: the choice not to engage is therefore voluntary. There is a strong push for self-sufficiency – believing that their social capital, wealth and status mean that they do not require the services of civic institutions. While not antagonistic towards such institutions, there is often a belief is that the services provided by the private sector are ultimately superior to public ones. Consequently, they feel empowered through their social background but are not engaged with civic institutions or the political process. Despite this, my initial research findings show that this group has a strong connection to decision-makers – both politicians and bureaucrats. This lack of engagement changes if there is a perceived injustice to their quality of life or their values system – and hence should not be dismissed as NIMBYs (not in my backyard). They believe they have the resources to mobilise and demand change. I believe that we see this group materialise in mobilisations around proposed developments that threaten the perceived quality of life of the local environment. One example brought to my attention was the rapid response of local residents to the proposed White City development near Sydney’s eastern suburbs that was to see tennis courts and public space replaced by residential and commercial buildings (Nicholls). As one resident informed me, she had never seen any political engagement by local residents previously – an engagement that was accompanied by a belief that the development would be stopped as well as a mobilisation of some impressive resources. Such mobilisations also occur when there is a perceived injustice. Examples of this group can be found in what Hugh Mackay (13) describes as ‘doctor’s wives’ (a term that I am not wholly comfortable with). Here we see the emergence of ‘Chilout’: Children out of Detention. This was an organisation whose membership was described to me as ‘north shore professionals’, drew heavily on those who believed the forced incarceration of young refugee children was an affront to their values system. 4. Insurgent Citizenship – Empowered and Engaged The final space is the insurgent citizen: that is, the citizen who is both engaged and empowered. This is a term borrowed from South Africa and the USA (Holston 1) – and it should be seen as having two, almost diametrically opposed, sides: progressive and reactionary. This group may not have access to a great deal of financial resources, but has high social capital and both a willingness and ability to engage in political processes. Consequently, there is a sense of empowerment and engagement with civic institutions. There is also a strong push for self-sufficiency – but this is encased in a belief that civic institutions have a responsibility to provide services to the public, and that some services are naturally better provided by the public sector. Despite this, there is often an antagonistic relationship with such institutions. From the progressive perspective, we see ‘activists’ promoting social justice issues (including students, academics, unionists and so on). Organisations such as A Just Australia are strongly supported by various student organisations, unions and other social justice and activist groups. From a reactionary perspective, we see the emergence of groups that take an anti-immigration stance (such as ‘anti-immigration’ groups including Australia First that draw both activists and have an established political party). (Information regarding ‘anti-refugee activists’ can be found at http://ausfirst.alphalink.com.au/ while the official website for the Australia First political part is at http://www.australiafirstparty.com.au/cms/.) One way to understand the relationship between these groups is through the engagement/empowered typology below. While a detailed discussion of the limitations of typologies is beyond the scope of this paper, it is important to acknowledge that any typology is a simplification and generalisation of the arguments presented. Likewise, it is unlikely that any typology has the ability to cover all cases and situations. This typology can, however, be used to underscore the relational nature of citizenship. The purpose here is to highlight that there are relationships between the different citizenship spaces and individuals can move between groups and each cluster has significant internal variation. Key here is that this can frame future studies. Conclusion and Next Steps There is little doubt there is a relationship between attitudes to citizenship and the health of a democracy. In Australia, democracy is robust in some ways, but many feel disempowered, disengaged and some feel both – often believing they are remote from the workings of civic institutions. It would appear that for many, interest in the process of (formal) government is at an all-time low as reflected in declining membership of political parties (Jaensch et al. 58). Democracy is not a ‘once for ever’ achievement – it needs to be protected and promoted. To do this, we must ensure that there are avenues for representation for all. This point also highlights one of the fundamental flaws of the aforementioned citizenship test. According to the Department of Immigration and Citizenship, the test is designed to: help migrants integrate and maximise the opportunities available to them in Australia, and enable their full participation in the Australian community as citizens. (par. 4) Those designing the test have assumed that citizenship is both stable and, once achieved, automatically ensures representation. This paper directly challenges these assumptions and offers an alternative research agenda with the ultimate aim of promoting high levels of engagement and empowerment. References Anderson, A. “The Liberals Have Not Betrayed the Menzies Legacy.” Online Opinion 25 Oct. 2004. < http://www.onlineopinion.com.au/view.asp?article=2679 >. Arvanitakis, J. “Highly Affected, Rarely Considered: The International Youth Parliament Commission’s Report on the Impacts of Globalisation on Young People.” Sydney: Oxfam Australia, 2003. Baldassar, L., Z. Kamalkhani, and C. Lange. “Afghan Hazara Refugees in Australia: Constructing Australian Citizens.” Social Identities 13.1 (2007): 31-50. Burchell, D. “Dysfunctional Dumping Grounds.” The Australian 10 Feb. 2007. < http://www.theaustralian.news.com.au/story/0,20867,21199266-28737,00.html >. Burnley, I.H. The Impact of Immigration in Australia: A Demographic Approach. Melbourne: Oxford UP, 2001. Castells, M. “European Cities, the Informational Society, and the Global Economy.” New Left Review I/204 (March-April 1994): 46-57. Chamberlain, C., and D. Mackenzie. Homeless Careers: Pathways in and out of Homelessness. Melbourne: RMIT University, 2002. Chari, R., J. Hogan, and G. Murphy. “Regulating Lobbyists: A Comparative Analysis of the United States, Canada, Germany and the European Union.” The Political Quarterly 78.3 (2007): 423-438. Collins, J. “Chinese Entrepreneurs: The Chinese Diaspora in Australia.” International Journal of Entrepreneurial Behaviour & Research 8.1/2 (2002): 113-133. Dee, M. “Young People, Citizenship and Public Space.” International Sociological Association Conference Paper, Brisbane, 2002. Della Porta, D. “Globalisations and Democracy.” Democratizations 12.5 (2005): 668-685. fa*gan, B., R. Dowling, and J. Longdale. “Suburbs in the ‘Global City’: Sydney since the Mid 1990s.” State of Australian cities conference. Parramatta, 2003. Frew, W. “And the Most Polarised City Is…” Sydney Morning Herald 16-17 Feb. 2008: 7. Gleeson, B. Australian Heartlands: Making Space for Hope in the Suburbs. Crows Nest: Allen and Unwin, 2006. Gleeson, B. “What’s Driving Suburban Australia?” Australian Policy Online 15 Jan. 2004. < http://www.apo.org.au/webboard/results.chtml?filename_num=00558 >. Gow, G. “Rubbing Shoulders in the Global City: Refugees, Citizenship and Multicultural Alliances in Fairfield, Sydney.” Ethnicities 5.3 (2005): 386-405. Hahn, C. L. “Citizenship Education: An Empirical Study of Policy, Practices and Outcomes.” Oxford Review of Education 25.1/2 (1999): 231-250. Hawley, S. “Sir Donald Bradman Likely to Be Dumped from Citizenship Test.” ABC Local Radio Online. 29 Jan. 2008. < http://www.abc.net.au/am/content/2007/s2148383.htm >. Hoare, D. “Bradman’s Spot in Citizenship Test under Scrutiny.” ABC Local Radio online. 29 Jan. 2008. < http://www.abc.net.au/pm/content/2008/s2149325.htm >. Holston, J. Insurgent Citizenship: Disjunctions of Democracy and Modernity in Brazil. California: Cloth, 2007. Jaensch, D., P. Brent, and B. Bowden. “Australian Political Parties in the Spotlight.” Democratic Audit of Australia Report 4. Australian National University, 2004. Mackay, H. “Sleepers Awoke from Slumber of Indifference.” Sydney Morning Herald 27 Nov. 2007: 13. NSWPD – New South Wales Parliamentary Debates. “South Western Sydney Banking Services.” Legislative Assembly Hansard, 52nd NSW Parliament, 19 Sep. 2001. Portney, K.E., and L. O’Leary. Civic and Political Engagement of America’s Youth: National Survey of Civic and Political Engagement of Young People. Medford, MA: Tisch College, Tufts University, 2007. Price, S. “Stress and Debt Make Sydney a Violent City.” Sydney Morning Herald 13 Jan. 2008: 16. Pusey, M. The Experience of Middle Australia: The Dark Side of Economic Reform. Cambridge: Cambridge UP, 2003. White, R. “Swarming and the Social Dynamics of Group Violence.” Trends and Issues in Crime and Criminal Justice 326 (Oct. 2006). < http://www.aic.gov.au/publications/tandi2/tandi326t.html >. Wolfe, P. “Race and Citizenship.” Magazine of History 18.5 (2004): 66-72.

Abstract:

Introduction One of the first challenges faced by new Australian Prime Minister, Kevin Rudd, was what to do with the former government’s controversial citizenship test. While a quick evaluation of the test shows that 93 percent of those who have sat it ‘passed’ (Hoare), most media controversy has focussed less on the validity of such a test than whether questions relating to Australian cricketing legend, Don Bradman, are appropriate (Hawley). While the citizenship test seems nothing more that a crude and populist measure imposed by the former Howard government in its ongoing nationalistic agenda, which included paying schools to raise the Australian flag (“PM Unfurls Flag”), its imposition seems a timely reminder of the challenge of understanding citizenship today. For as the demographic structures around us continue to change, so must our understandings of ‘citizenship’. More importantly, this fluid understanding of citizenship is not limited to academics, and policy-makers, but new technologies, the processes of globalisation including a globalised media, changing demographic patterns including migration, as well as environmental challenges that place pressure on limited resources is altering the citizens understanding of their own role as well as those around them. This paper aims to sketch out a proposed new research agenda that seeks to investigate this fluid and heterogenous nature of citizenship. The focus of the research has so far been Sydney and is enveloped by a broader aim of promoting an increased level of citizen engagement both within formal and informal political structures. I begin by sketching the complex nature of Sydney before presenting some initial research findings. Sydney – A Complex City The so-called ‘emerald city’ of Sydney has been described in many ways: from a ‘global’ city (fa*gan, Dowling and Longdale 1) to an ‘angry’ city (Price 16). Sarah Price’s investigative article included research from the University of Western Sydney’s Centre of Culture Research, the Bureau of Crime Statistics and interviews with Tony Grabs, the director of trauma at St Vincent’s Hospital in inner city Darlinghurst. Price found that both injuries from alcohol and drug-related violence had risen dramatically over the last few years and seemed to be driven by increasing frustrations of a city that is perceived to be lacking appropriate infrastructure and rising levels of personal and household debt. Sydney’s famous harbour and postcard landmarks are surrounded by places of controversy and poverty, with residents of very backgrounds living in close proximity: often harmoniously and sometimes less so. According to recent research by Griffith University’s Urban Research Program, the city is becoming increasingly polarised, with the wealthiest enjoying high levels of access to amenities while other sections of the population experiencing increasing deprivation (Frew 7). Sydney, is often segmented into different regions: the growth corridors of the western suburbs which include the ‘Aspirational class’; the affluent eastern suburb; the southern beachside suburbs surrounding Cronulla affectionately known by local residents as ‘the Shire’, and so on. This, however, hides that fact that these areas are themselves complex and heterogenous in character (Frew 7). As a result, the many clichés associated with such segments lead to an over simplification of regional characteristics. The ‘growth corridors’ of Western Sydney, for example, have, in recent times, become a focal point of political and social commentary. From the rise of the ‘Aspirational’ voter (Anderson), seen to be a key ‘powerbroker’ in federal and state politics, to growing levels of disenfranchised young people, this region is multifaceted and should not be simplified. These areas often see large-scale, private housing estates; what Brendan Gleeson describes as ‘privatopias’, situated next to rising levels of homelessness (“What’s Driving”): a powerful and concerning image that should not escape our attention. (Chamberlain and Mackenzie pay due attention to the issue in Homeless Careers.) It is also home to a growing immigrant population who often arrive as business migrants and as well as a rising refugee population traumatised by war and displacement (Collins 1). These growth corridors then, seem to simultaneously capture both the ambitions and the fears of Sydney. That is, they are seen as both areas of potential economic boom as well as social stress and potential conflict (Gleeson 89). One way to comprehend the complexity associated with such diversity and change is to reflect on the proximity of the twin suburbs of Macquarie Links and Macquarie Fields situated in Sydney’s south-western suburbs. Separated by the clichéd ‘railway tracks’, one is home to the growing Aspirational class while the other continues to be plagued by the stigma of being, what David Burchell describes as, a ‘dysfunctional dumping ground’ whose plight became national headlines during the riots in 2005. The riots were sparked after a police chase involving a stolen car led to a crash and the death of a 17 year-old and 19 year-old passengers. Residents blamed police for the deaths and the subsequent riots lasted for four nights – involving 150 teenagers clashing with New South Wales Police. The dysfunction, Burchell notes is seen in crime statistics that include 114 stolen cars, 227 burglaries, 457 cases of property damage and 279 assaults – all in 2005 alone. Interestingly, both these populations are surrounded by exclusionary boundaries: one because of the financial demands to enter the ‘Links’ estate, and the other because of the self-imposed exclusion. Such disparities not only provide challenges for policy makers generally, but also have important implications on the attitudes that citizens’ experience towards their relationship with each other as well as the civic institutions that are meant to represent them. This is particular the case if civic institutions are seen to either neglect or favour certain groups. This, in part, has given rise to what I describe here as a ‘citizenship surplus’ as well as a ‘citizenship deficit’. Research Agenda: Investigating Citizenship Surpluses and Deficits This changing city has meant that there has also been a change in the way that different groups interact with, and perceive, civic bodies. As noted, my initial research shows that this has led to the emergence of both citizenship surpluses and deficits. Though the concept of a ‘citizen deficits and surpluses’ have not emerged within the broader literature, there is a wide range of literature that discusses how some sections of the population lack of access to democratic processes. There are three broad areas of research that have emerged relevant here: citizenship and young people (see Arvanitakis; Dee); citizenship and globalisation (see Della Porta; Pusey); and citizenship and immigration (see Baldassar et al.; Gow). While a discussion of each of these research areas is beyond the scope of this paper, a regular theme is the emergence of a ‘democratic deficit’ (Chari et al. 422). Dee, for example, looks at how there exist unequal relationships between local and central governments, young people, communities and property developers in relation to space. Dee argues that this shapes social policy in a range of settings and contexts including their relationship with broader civic institutions and understandings of citizenship. Dee finds that claims for land use that involve young people rarely succeed and there is limited, if any, recourse to civic institutions. As such, we see a democratic deficit emerge because the various civic institutions involved fail in meeting their obligations to citizens. In addition, a great deal of work has emerged that investigates attempts to re-engage citizens through mechanisms to promote citizenship education and a more active citizenship which has also been accompanied by government programs with the same goals (See for example the Western Australian government’s ‘Citizenscape’ program ). For example Hahn (231) undertakes a comparative study of civic education in six countries (including Australia) and the policies and practices with respect to citizenship education and how to promote citizen activism. The results are positive, though the research was undertaken before the tumultuous events of the terrorist attacks in New York, the emergence of the ‘war on terror’ and the rise of ‘Muslim-phobia’. A gap rises, however, within the Australian literature when we consider both the fluid and heterogenous nature of citizenship. That is, how do we understand the relationship between these diverse groups living within such proximity to each other overlayed by changing migration patterns, ongoing globalised processes and changing political environments as well as their relations to civic institutions? Further, how does this influence the way individuals perceive their rights, expectations and responsibilities to the state? Given this, I believe that there is a need to understand citizenship as a fluid and heterogenous phenomenon that can be in surplus, deficit, progressive and reactionary. When discussing citizenship I am interested in how people perceive both their rights and responsibilities to civic institutions as well as to the residents around them. A second, obviously related, area of interest is ‘civic engagement’: that is, “the activities of people in the various organisations and associations that make up what scholars call ‘civil society’” (Portney and Leary 4). Before describing these categories in more detail, I would like to briefly outline the methodological processes employed thus far. Much of the research to this point is based on a combination of established literature, my informal discussions with citizen groups and my observations as ‘an activist.’ That is, over the last few years I have worked with a broad cross section of community-based organisations as well as specific individuals that have attempted to confront perceived injustices. I have undertaken this work as both an activist – with organisations such as Aid/Watch and Oxfam Australia – as well as an academic invited to share my research. This work has involved designing and implementing policy and advocacy strategies including media and public education programs. All interactions begin with a detailed discussion of the aims, resources, abilities and knowledge of the groups involved, followed by workshopping campaigning strategies. This has led to the publication of an ‘activist handbook’ titled ‘From Sitting on the Couch to Changing the World’, which is used to both draft the campaign aims as well as design a systematic strategy. (The booklet, which is currently being re-drafted, is published by Oxfam Australia and registered under a creative commons licence. For those interested, copies are available by emailing j.arvanitakis (at) uws.edu.au.) Much research is also sourced from direct feedback given by participants in reviewing the workshops and strategies The aim of tis paper then, is to sketch out the initial findings as well as an agenda for more formalised research. The initial findings have identified the heterogenous nature of citizenship that I have separated into four ‘citizenship spaces.’ The term space is used because these are not stable groupings as many quickly move between the areas identified as both the structures and personal situations change. 1. Marginalisation and Citizenship Deficit The first category is a citizenship deficit brought on by a sense of marginalisation. This is determined by a belief that it is pointless to interact with civic institutions, as the result is always the same: people’s opinions and needs will be ignored. Or in the case of residents from areas such as Macquarie Fields, the relationship with civic institutions, including police, is antagonistic and best avoided (White par. 21). This means that there is no connection between the population and the civic institutions around them – there is no loyalty or belief that efforts to be involved in political and civic processes will be rewarded. Here groups sense that they do not have access to political avenues to be heard, represented or demand change. This is leading to an experience of disconnection from political processes. The result is both a sense of disengagement and disempowerment. One example here emerged in discussions with protesters around the proposed development of the former Australian Defence Industry (ADI) site in St Marys, an outer-western suburb of Sydney. The development, which was largely approved, was for a large-scale housing estate proposed on sensitive bushlands in a locality that resident’s note is under-serviced in terms of public space. (For details of these discussions, see http://www.adisite.org/.) Residents often took the attitude that whatever the desire of the local community, the development would go ahead regardless. Those who worked at information booths during the resident protests informed me that the attitude was one best summarised by: “Why bother, we always get stuffed around any way.” This was confirmed by my own discussions with local residents – even those who joined the resident action group. 2. Privatisation and Citizenship Deficit This citizenship deficit not only applies to the marginalised, however, for there are also much wealthier populations who also appear to experience a deficit that results from a lack of access to civic institutions. This tends to leads to a privatisation of decision-making and withdrawal from the public arena as well as democratic processes. Consequently, the residents in the pockets of wealth may not be acting as citizens but more like consumers – asserting themselves in terms of Castells’s ‘collective consumption’ (par. 25). This citizenship deficit is brought on by ongoing privatisation. That is, there is a belief that civic institutions (including government bodies) are unable or at least unwilling to service the local community. As a result there is a tendency to turn to private suppliers and believe that individualisation is the best way to manage the community. The result is that citizens feel no connection to the civic institutions around them, not because there is no desire, but there are no services. This group of citizens has often been described as the ‘Aspirationals’ and are most often found in the growth corridors of Sydney. There is no reason to believe that this group is this way because of choice – but rather a failure by government authorities to service their needs. This is confirmed by research undertaken as early as 1990 which found that the residents now labelled Aspirational, were demanding access to public infrastructure services including public schools, but have been neglected by different levels of government. (This was clearly stated by NSW Labor MP for Liverpool, Paul Lynch, who argued for such services as a way to ensure a functioning community particularly for Western Sydney; NSWPD 2001.) As a result there is a reliance on private schools, neighbourhoods, transport and so on. Any ‘why bother’ attitude is thus driven by a lack of evidence that civic institutions can or are not willing to meet their needs. There is a strong sense of local community – but this localisation limited to others in the same geographical location and similar lifestyle. 3. Citizenship Surplus – Empowered Not Engaged The third space of citizenship is based on a ‘surplus’ even if there is limited or no political engagement. This group has quite a lot in common with the ‘Aspirationals’ but may come from areas that are higher serviced by civic institutions: the choice not to engage is therefore voluntary. There is a strong push for self-sufficiency – believing that their social capital, wealth and status mean that they do not require the services of civic institutions. While not antagonistic towards such institutions, there is often a belief is that the services provided by the private sector are ultimately superior to public ones. Consequently, they feel empowered through their social background but are not engaged with civic institutions or the political process. Despite this, my initial research findings show that this group has a strong connection to decision-makers – both politicians and bureaucrats. This lack of engagement changes if there is a perceived injustice to their quality of life or their values system – and hence should not be dismissed as NIMBYs (not in my backyard). They believe they have the resources to mobilise and demand change. I believe that we see this group materialise in mobilisations around proposed developments that threaten the perceived quality of life of the local environment. One example brought to my attention was the rapid response of local residents to the proposed White City development near Sydney’s eastern suburbs that was to see tennis courts and public space replaced by residential and commercial buildings (Nicholls). As one resident informed me, she had never seen any political engagement by local residents previously – an engagement that was accompanied by a belief that the development would be stopped as well as a mobilisation of some impressive resources. Such mobilisations also occur when there is a perceived injustice. Examples of this group can be found in what Hugh Mackay (13) describes as ‘doctor’s wives’ (a term that I am not wholly comfortable with). Here we see the emergence of ‘Chilout’: Children out of Detention. This was an organisation whose membership was described to me as ‘north shore professionals’, drew heavily on those who believed the forced incarceration of young refugee children was an affront to their values system. 4. Insurgent Citizenship – Empowered and Engaged The final space is the insurgent citizen: that is, the citizen who is both engaged and empowered. This is a term borrowed from South Africa and the USA (Holston 1) – and it should be seen as having two, almost diametrically opposed, sides: progressive and reactionary. This group may not have access to a great deal of financial resources, but has high social capital and both a willingness and ability to engage in political processes. Consequently, there is a sense of empowerment and engagement with civic institutions. There is also a strong push for self-sufficiency – but this is encased in a belief that civic institutions have a responsibility to provide services to the public, and that some services are naturally better provided by the public sector. Despite this, there is often an antagonistic relationship with such institutions. From the progressive perspective, we see ‘activists’ promoting social justice issues (including students, academics, unionists and so on). Organisations such as A Just Australia are strongly supported by various student organisations, unions and other social justice and activist groups. From a reactionary perspective, we see the emergence of groups that take an anti-immigration stance (such as ‘anti-immigration’ groups including Australia First that draw both activists and have an established political party). (Information regarding ‘anti-refugee activists’ can be found at http://ausfirst.alphalink.com.au/ while the official website for the Australia First political part is at http://www.australiafirstparty.com.au/cms/.) One way to understand the relationship between these groups is through the engagement/empowered typology below. While a detailed discussion of the limitations of typologies is beyond the scope of this paper, it is important to acknowledge that any typology is a simplification and generalisation of the arguments presented. Likewise, it is unlikely that any typology has the ability to cover all cases and situations. This typology can, however, be used to underscore the relational nature of citizenship. The purpose here is to highlight that there are relationships between the different citizenship spaces and individuals can move between groups and each cluster has significant internal variation. Key here is that this can frame future studies. Conclusion and Next Steps There is little doubt there is a relationship between attitudes to citizenship and the health of a democracy. In Australia, democracy is robust in some ways, but many feel disempowered, disengaged and some feel both – often believing they are remote from the workings of civic institutions. It would appear that for many, interest in the process of (formal) government is at an all-time low as reflected in declining membership of political parties (Jaensch et al. 58). Democracy is not a ‘once for ever’ achievement – it needs to be protected and promoted. To do this, we must ensure that there are avenues for representation for all. This point also highlights one of the fundamental flaws of the aforementioned citizenship test. According to the Department of Immigration and Citizenship, the test is designed to: help migrants integrate and maximise the opportunities available to them in Australia, and enable their full participation in the Australian community as citizens. (par. 4) Those designing the test have assumed that citizenship is both stable and, once achieved, automatically ensures representation. This paper directly challenges these assumptions and offers an alternative research agenda with the ultimate aim of promoting high levels of engagement and empowerment. References Anderson, A. “The Liberals Have Not Betrayed the Menzies Legacy.” Online Opinion 25 Oct. 2004. http://www.onlineopinion.com.au/view.asp?article=2679>. Arvanitakis, J. “Highly Affected, Rarely Considered: The International Youth Parliament Commission’s Report on the Impacts of Globalisation on Young People.” Sydney: Oxfam Australia, 2003. Baldassar, L., Z. Kamalkhani, and C. Lange. “Afghan Hazara Refugees in Australia: Constructing Australian Citizens.” Social Identities 13.1 (2007): 31-50. Burchell, D. “Dysfunctional Dumping Grounds.” The Australian 10 Feb. 2007. http://www.theaustralian.news.com.au/story/0,20867,21199266-28737,00.html>. Burnley, I.H. The Impact of Immigration in Australia: A Demographic Approach. Melbourne: Oxford UP, 2001. Castells, M. “European Cities, the Informational Society, and the Global Economy.” New Left Review I/204 (March-April 1994): 46-57. Chamberlain, C., and D. Mackenzie. Homeless Careers: Pathways in and out of Homelessness. Melbourne: RMIT University, 2002. Chari, R., J. Hogan, and G. Murphy. “Regulating Lobbyists: A Comparative Analysis of the United States, Canada, Germany and the European Union.” The Political Quarterly 78.3 (2007): 423-438. Collins, J. “Chinese Entrepreneurs: The Chinese Diaspora in Australia.” International Journal of Entrepreneurial Behaviour & Research 8.1/2 (2002): 113-133. Dee, M. “Young People, Citizenship and Public Space.” International Sociological Association Conference Paper, Brisbane, 2002. Della Porta, D. “Globalisations and Democracy.” Democratizations 12.5 (2005): 668-685. fa*gan, B., R. Dowling, and J. Longdale. “Suburbs in the ‘Global City’: Sydney since the Mid 1990s.” State of Australian cities conference. Parramatta, 2003. Frew, W. “And the Most Polarised City Is…” Sydney Morning Herald 16-17 Feb. 2008: 7. Gleeson, B. Australian Heartlands: Making Space for Hope in the Suburbs. Crows Nest: Allen and Unwin, 2006. Gleeson, B. “What’s Driving Suburban Australia?” Australian Policy Online 15 Jan. 2004. http://www.apo.org.au/webboard/results.chtml?filename_num=00558>. Gow, G. “Rubbing Shoulders in the Global City: Refugees, Citizenship and Multicultural Alliances in Fairfield, Sydney.” Ethnicities 5.3 (2005): 386-405. Hahn, C. L. “Citizenship Education: An Empirical Study of Policy, Practices and Outcomes.” Oxford Review of Education 25.1/2 (1999): 231-250. Hawley, S. “Sir Donald Bradman Likely to Be Dumped from Citizenship Test.” ABC Local Radio Online. 29 Jan. 2008. http://www.abc.net.au/am/content/2007/s2148383.htm>. Hoare, D. “Bradman’s Spot in Citizenship Test under Scrutiny.” ABC Local Radio online. 29 Jan. 2008. http://www.abc.net.au/pm/content/2008/s2149325.htm>. Holston, J. Insurgent Citizenship: Disjunctions of Democracy and Modernity in Brazil. California: Cloth, 2007. Jaensch, D., P. Brent, and B. Bowden. “Australian Political Parties in the Spotlight.” Democratic Audit of Australia Report 4. Australian National University, 2004. Mackay, H. “Sleepers Awoke from Slumber of Indifference.” Sydney Morning Herald 27 Nov. 2007: 13. NSWPD – New South Wales Parliamentary Debates. “South Western Sydney Banking Services.” Legislative Assembly Hansard, 52nd NSW Parliament, 19 Sep. 2001. Portney, K.E., and L. O’Leary. Civic and Political Engagement of America’s Youth: National Survey of Civic and Political Engagement of Young People. Medford, MA: Tisch College, Tufts University, 2007. Price, S. “Stress and Debt Make Sydney a Violent City.” Sydney Morning Herald 13 Jan. 2008: 16. Pusey, M. The Experience of Middle Australia: The Dark Side of Economic Reform. Cambridge: Cambridge UP, 2003. White, R. “Swarming and the Social Dynamics of Group Violence.” Trends and Issues in Crime and Criminal Justice 326 (Oct. 2006). http://www.aic.gov.au/publications/tandi2/tandi326t.html>. Wolfe, P. “Race and Citizenship.” Magazine of History 18.5 (2004): 66-72. Citation reference for this article MLA Style Arvanitakis, James. "The Heterogenous Citizen: How Many of Us Care about Don Bradman’s Average?." M/C Journal 10.6/11.1 (2008). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0804/07-arvanitakis.php>. APA Style Arvanitakis, J. (Apr. 2008) "The Heterogenous Citizen: How Many of Us Care about Don Bradman’s Average?," M/C Journal, 10(6)/11(1). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0804/07-arvanitakis.php>.

Abstract:

There is a moment in Al Gore’s 2006 documentary An Inconvenient Truth devised to expose the sheer audacity of fossil fuel lobby groups in the United States. In their attempts to address significant scientific consensus and growing public concern over climate change, these groups are resorting to what Gore’s film suggests are grotesque distortions of fact. A particular example highlighted in the film is the Competitive Enterprise Institute’s (CPE—a lobby group funded by ExxonMobil) “pro” energy industry advertisem*nt: “Carbon dioxide”, the ad states. “They call it pollution, we call it life.” While on the one hand employing rhetoric against the “inconvenient truth” that carbon dioxide emissions are ratcheting up the Earth’s temperature, these advertisem*nts also pose a question – though perhaps unintended – that is worth addressing. Where does life reside? This is not an issue of essentialism, but relates to the claims, materials and technologies through which life as a political object emerges. The danger of entertaining the vested interests of polluting industry in a discussion of climate change and its biopolitics is countered by an imperative to acknowledge the ways in which multiple positions in the climate change debate invoke and appeal to ‘life’ as the bottom line, or inviolable interest, of their political, social or economic work. In doing so, other questions come to the fore that a politics of climate change framed in terms of moral positions or competing values will tend to overlook. These questions concern the manifold practices of life that constitute the contemporary terrain of the political, and the actors and instruments put in this employ. Who speaks for life? And who or what produces it? Climate change as a matter of concern (Latour) has gathered and generated a host of experts, communities, narratives and technical devices all invested in the administration of life. It is, as Malcom Bull argues, “the paradigmatic issue of the new politics,” a politics which “draws people towards the public realm and makes life itself subject to the caprices of state and market” (2). This paper seeks to highlight the politics of life that have emerged around climate change as a public issue. It will argue that these politics appear in incremental and multiple ways that situate an array of actors and interests as active in both contesting and generating the terms of life: what life is and how we come to know it. This way of thinking about climate change debates opposes a prevalent moralistic framework that reads the practices and discourses of debate in terms of oppositional positions alone. While sympathies may flow in varying directions, especially when it comes to such a highly charged and massively consequential issue as climate change, there is little insight to be had from charging the CPE (for example) with manipulating consumers, or misrepresenting well-known facts. Where new and more productive understandings open up is in relation to the fields through which these gathering actors play out their claims to the project of life. These fields, from the state, to the corporation, to the domestic sphere, reveal a complex network of strategies and devices that seek to secure life in constantly renovated terms. Life Politics Biopolitical scholarship in the wake of Foucault has challenged life as a pre-given uncritical category, and sought to highlight the means through which it is put under question and constituted through varying and composing assemblages of practitioners and practices. Such work regards the project of human well-being as highly complex and technical, and has undertaken to document this empirically through close attention to the everyday ecologies in which humans are enmeshed. This is a political and theoretical project in itself, situating political processes in micro, as well as macro, registers, including daily life as a site of (self) management and governance. Rabinow and Rose refer to biopolitical circuits that draw together and inter-relate the multiple sites and scales operative in the administration of life. These involve not just technologies, rationalities and regimes of authority and control, but also politics “from below” in the form of rights claims and community formation and agitation (198). Active in these circuits, too, are corporate and non-state interests for whom the pursuit of maximising life’s qualities and capabilities has become a concern through which “market relations and shareholder value” are negotiated (Rabinow and Rose 211). As many biopolitical scholars argue, biopower—the strategies through which biopolitics are enacted—is characteristic of the “disciplinary neo-liberalism” that has come to define the modern state, and through which the conduct of conduct is practiced (Di Muzio 305). Foucault’s concept of governmentality describes the devolution of state-based disciplinarity and sovereignty to a host of non-state actors, rationalities and strategies of governing, including the self-managing subject, not in opposition to the state, but contributing to its form. According to Bratich, Packer and McCarthy, everyday life is thus “saturated with governmental techniques” (18) in which we are all enrolled. Unlike regimes of biopolitics identified with what Agamben terms “thanopolitics”—the exercise of biopower “which ultimately rests on the power of some to threaten the death of others” (Rabinow and Rose 198), such as the Nazi’s National Socialism and other eugenic campaigns—governmental arts in the service of “vitalist” biopolitics (Rose 1) are increasingly diffused amongst all those with an “interest” in sustaining life, from organisations to individuals. The integration of techniques of self-governance which ask the individual to work on themselves and their own dispositions with State functions has broadened the base by which life is governed, and foregrounded an unsettled terrain of life claims. Rose argues that medical science is at the forefront of these contemporary biopolitics, and to this effect “has […] been fully engaged in the ethical questions of how we should live—of what kinds of creatures we are, of the kinds of obligations that we have to ourselves and to others, of the kinds of techniques we can and should use to improve ourselves” (20). Asking individuals to self-identify through their medical histories and bodily specificities, medical cultures are also shaping new political arrangements, as communities connected by shared genetics or physical conditions, for instance, emerge, evolve and agitate according to the latest medical knowledge. Yet it is not just medicine that provokes ethical work and new political forms. The environment is a key site for life politics that entails a multi-faceted discourse of obligations and entitlements, across fields and scales of engagement. Calculating Environments In line with neo-liberal logic, environmental discourse concerned with ameliorating climate change has increasingly focused upon the individual as an agent of self-monitoring, to both facilitate government agendas at a distance, and to “self-fashion” in the mode of the autonomous subject, securing against external risks (Ong 501). Climate change is commonly represented as such a risk, to both human and non-human life. A recent letter published by the Royal Australasian College of Physicians in two leading British medical journals, named climate change as the “biggest global health threat of the twenty-first century” (Morton). As I have argued elsewhere (Potter), security is central to dominant cultures of environmental governance in the West; these cultures tie sustainability goals to various and interrelated regimes of monitoring which attach to concepts of what Clark and Stevenson call “the good ecological citizen” (238). Citizenship is thus practiced through strategies of governmentality which call on individuals to invest not just in their own well-being, but in the broader project of life. Calculation is a primary technique through which modern environmental governance is enacted; calculative strategies are seen to mediate risk, according to Foucault, and consequently to “assure living” (Elden 575). Rationalised schemes for self-monitoring are proliferating under climate change and the project of environmentalism more broadly, something which critics of neo-liberalism have identified as symptomatic of the privatisation of politics that liberal governmentality has fostered. As we have seen in Australia, an evolving policy emphasis on individual practices and the domestic sphere as crucial sites of environmental action – for instance, the introduction of domestic water restrictions, and the phasing out of energy-inefficient light bulbs in the home—provides a leading discourse of ethico-political responsibility. The rise of carbon dioxide counting is symptomatic of this culture, and indicates the distributed fields of life management in contemporary governmentality. Carbon dioxide, as the CPE is keen to point out, is crucial to life, but it is also—in too large an amount—a force of destruction. Its management, in vitalist terms, is thus established as an effort to protect life in the face of death. The concept of “carbon footprinting” has been promoted by governments, NGOs, industry and individuals as a way of securing this goal, and a host of calculative techniques and strategies are employed to this end, across a spectrum of activities and contexts all framed in the interests of life. The footprinting measure seeks to secure living via self-policed limits, which also—in classic biopolitical form—shift previously private practices into a public realm of count-ability and accountability. The carbon footprint, like its associates the ecological footprint and the water footprint, has developed as a multi-faceted tool of citizenship beyond the traditional boundaries of the state. Suggesting an ecological conception of territory and of our relationships and responsibilities to this, the footprint, as a measure of resource use and emissions relative to the Earth’s capacities to absorb these, calculates and visualises the “specific qualities” (Elden 575) that, in a spatialised understanding of security, constitute and define this territory. The carbon footprint’s relatively simple remit of measuring carbon emissions per unit of assessment—be that the individual, the corporation, or the nation—belies the ways in which life is formatted and produced through its calculations. A tangled set of devices, practices and discourses is employed to make carbon and thus life calculable and manageable. Treading Lightly The old environmental adage to “tread lightly upon the Earth” has been literalised in the metaphor of the footprint, which attempts both to symbolise environmental practice and to directly translate data in order to meaningfully communicate necessary boundaries for our living. The World Wildlife Fund’s Living Planet Report 2008 exemplifies the growing popularity of the footprint as a political and poetic hook: speaking in terms of our “ecological overshoot,” and the move from “ecological credit to ecological deficit”, the report urges an attendance to our “global footprint” which “now exceeds the world’s capacity to regenerate by about 30 per cent” (1). Angela Crombie’s A Lighter Footprint, an instruction manual for sustainable living, is one of a host of media through which individuals are educated in modes of footprint calculation and management. She presents a range of techniques, including carbon offsetting, shifting to sustainable modes of transport, eating and buying differently, recycling and conserving water, to mediate our carbon dioxide output, and to “show […] politicians how easy it is” (13). Governments however, need no persuading from citizens that carbon calculation is an exercise to be harnessed. As governments around the world move (slowly) to address climate change, policies that instrumentalise carbon dioxide emission and reduction via an auditing of credits and deficits have come to the fore—for example, the European Union Emissions Trading Scheme and the Chicago Climate Exchange. In Australia, we have the currently-under-debate Carbon Pollution Reduction Scheme, a part of which is the Australian Emissions Trading Scheme (AETS) that will introduce a system of “carbon credits” and trading in a market-based model of supply and demand. This initiative will put a price on carbon dioxide emissions, and cap the amount of emissions any one polluter can produce without purchasing further credits. In readiness for the scheme, business initiatives are forming to take advantage of this new carbon market. Industries in carbon auditing and off-setting services are consolidating; hectares of trees, already active in the carbon sequestration market, are being cultivated as “carbon sinks” and key sites of compliance for polluters under the AETS. Governments are also planning to turn their tracts of forested public land into carbon credits worth billions of dollars (Arup 7). The attachment of emission measures to goods and services requires a range of calculative experts, and the implementation of new marketing and branding strategies, aimed at conveying the carbon “health” of a product. The introduction of “food mile” labelling (the amount of carbon dioxide emitted in the transportation of the food from source to consumer) in certain supermarkets in the United Kingdom is an example of this. Carbon risk analysis and management programs are being introduced across businesses in readiness for the forthcoming “carbon economy”. As one flyer selling “a suite of carbon related services” explains, “early action will give you the edge in understanding and mitigating the risks, and puts you in a prime position to capitalise on the rewards” (MGI Business Solutions Worldwide). In addition, lobby groups are working to ensure exclusions from or the free allocation of permits within the proposed AETS, with degrees of compulsion applied to different industries – the Federal Government, for instance, will provide a $3.9 billion compensation package for the electric power sector when the AETS commences, to enable their “adjustment” to this carbon regime. Performing Life Noortje Mares provides a further means of thinking through the politics of life in the context of climate change by complicating the distinction between public and private interest. Her study of “green living experiments” describes the rise of carbon calculation in the home in recent years, and the implementation of technologies such as the smart electricity meter that provides a constantly updating display of data relating to amounts and cost of energy consumed and the carbon dioxide emitted in the routines of domestic life. Her research tracks the entry of these personal calculative regimes into public life via internet forums such as blogs, where individuals notate or discuss their experiences of pursing low-carbon lifestyles. On the one hand, these calculative practices of living and their public representation can be read as evidencing the pervasive neo-liberal governmentality at work in contemporary environmental practice, where individuals are encouraged to scrupulously monitor their domestic cultures. The rise of auditing as a technology of self, and more broadly as a technique of public accountability, has come under fire for its “immunity-granting role” (Charkiewicz 79), where internal audits become substituted for external compliance and regulation. Mares challenges this reading, however, by demonstrating the ways in which green living experiments “transform everyday material practices into practices of public involvement” that (118) don’t resolve or pin down relations between the individual, the non-human environment, and the social, or reveal a mappable flow of actions and effects between the public realm and the home. The empirical modes of publicity that these individuals employ, “the careful recording of measurements and the reliable descriptions of sensory observation, so as to enable ‘virtual witnessing’ by wider audiences”, open up to much more complex understandings than one of calculative self-discipline at work. As “instrument[s] of public involvement” (120), the experiments that Mares describe locate the politics of life in the embodied socio-material entanglements of the domestic sphere, in arrangements of humans and non-human technologies. Such arrangements, she suggests, are ontologically productive in that they introduce “not only new knowledge, but also new entities […] to society” (119), and as such these experiments and the modes of calculation they employ become active in the composition of reality. Recent work in economic sociology and cultural studies has similarly contended that calculation, far from either a naturalised or thoroughly abstract process, relies upon a host of devices, relations, and techniques: that is, as Gay Hawkins explains, calculative processes “have to be enacted” (108). Environmental governmentality in the service of securing life is a networked practice that draws in a host of actors, not a top-down imposition. The institution of carbon economies and carbon emissions as a new register of public accountability, brings alternative ways to calculate the world into being, and consequently re-calibrates life as it emerges from these heterogeneous arrangements. All That Gathers Latour writes that we come to know a matter of concern by all the things that gather around it (Latour). This includes the human, as well as the non-human actors, policies, practices and technologies that are put to work in the making of our realities. Climate change is routinely represented as a threat to life, with predicted (and occurring) species extinction, growing numbers of climate change refugees, dispossessed from uninhabitable lands, and the rise of diseases and extreme weather scenarios that put human life in peril. There is no doubt, of course, that climate change does mean death for some: indeed, there are thanopolitical overtones in inequitable relations between the fall-out of impacts from major polluting nations on poorer countries, or those much more susceptible to rising sea levels. Biosocial equity, as Bull points out, is a “matter of being equally alive and equally dead” (2). Yet in the biopolitical project of assuring living, life is burgeoning around the problem of climate change. The critique of neo-liberalism as a blanketing system that subjects all aspects of life to market logic, and in which the cynical techniques of industry seek to appropriate ethico-political stances for their own material ends, are insufficient responses to what is actually unfolding in the messy terrain of climate change and its biopolitics. What this paper has attempted to show is that there is no particular purchase on life that can be had by any one actor who gathers around this concern. Varying interests, ambitions, and intentions, without moral hierarchy, stake their claim in life as a constantly constituting site in which they participate, and from this perspective, the ways in which we understand life to be both produced and managed expand. This is to refuse either an opposition or a conflation between the market and nature, or the market and life. It is also to argue that we cannot essentialise human-ness in the climate change debate. For while human relations with animals, plants and weathers may make us what we are, so too do our relations with (in a much less romantic view) non-human things, technologies, schemes, and even markets—from carbon auditing services, to the label on a tin on the supermarket shelf. As these intersect and entangle, the project of life, in the new politics of climate change, is far from straightforward. References An Inconvenient Truth. Dir. Davis Guggenheim. Village Roadshow, 2006. Arup, Tom. “Victoria Makes Enormous Carbon Stocktake in Bid for Offset Billions.” The Age 24 Sep. 2009: 7. Bratich, Jack Z., Jeremy Packer, and Cameron McCarthy. “Governing the Present.” Foucault, Cultural Studies and Governmentality. Ed. Bratich, Packer and McCarthy. Albany: State University of New York Press, 2003. 3-21. Bull, Malcolm. “Globalization and Biopolitics.” New Left Review 45 (2007): 12 May 2009 . < http://newleftreview.org/?page=article&view=2675 >. Charkiewicz, Ewa. “Corporations, the UN and Neo-liberal Bio-politics.” Development 48.1 (2005): 75-83. Clark, Nigel, and Nick Stevenson. “Care in a Time of Catastrophe: Citizenship, Community and the Ecological Imagination.” Journal of Human Rights 2.2 (2003): 235-246. Crombie, Angela. A Lighter Footprint: A Practical Guide to Minimising Your Impact on the Planet. Carlton North, Vic.: Scribe, 2007. Di Muzio, Tim. “Governing Global Slums: The Biopolitics of Target 11.” Global Governance. 14.3 (2008): 305-326. Elden, Stuart. “Governmentality, Calculation and Territory.” Environment and Planning D: Society and Space 25 (2007): 562-580. Hawkins, Gay. The Ethics of Waste: How We Relate to Rubbish. Sydney: University of New South Wales Press, 2006. Latour, Bruno. “Why Has Critique Run Out of Steam?: From Matters of Fact to Matters of Concern.” Critical Inquiry 30.2 (2004): 225-248. Mares, Noortje. “Testing Powers of Engagement: Green Living Experiments, the Ontological Turn and the Undoability and Involvement.” European Journal of Social Theory 12.1 (2009): 117-133. MGI Business Solutions Worldwide. “Carbon News.” Adelaide. 2 Aug. 2009. Ong, Aihwa. “Mutations in Citizenship.” Theory, Culture and Society 23.2-3 (2006): 499-505. Potter, Emily. “Footprints in the Mallee: Climate Change, Sustaining Communities, and the Nature of Place.” Landscapes and Learning: Place Studies in a Global World. Ed. Margaret Somerville, Kerith Power and Phoenix de Carteret. Sense Publishers. Forthcoming. Rabinow, Paul, and Nikolas Rose. “Biopower Today.” Biosocieties 1 (2006): 195-217. Rose, Nikolas. “The Politics of Life Itself.” Theory, Culture and Society 18.6 (2001): 1-30. World Wildlife Fund. Living Planet Report 2008. Switzerland, 2008.

Abstract:

In the heady expansion of capital’s productive capacity during the post-war period, E.P. Thompson wondered optimistically at potentials accruing to humanity by accelerating automation. He asked, “If we are to have enlarged leisure, in an automated future, the problem is not ‘how are men going to be able to consume all these additional time-units of leisure?’ but ‘what will be the capacity for experience of the men who have this undirected time to live?’” (Thompson 36). Indeed, linear and economistic variants of Marxian materialism have long emphasised that the socialisation of production by the use of machinery will eventually free us from work. At the very least, the underemployment produced by the automation of pivotal labour roles is supposed to create a political subject capable of agitating successfully against bourgeois and capitalist hegemony. But contrary to these prognostications, the worker of 2019 is caught up in a process of generalising work far beyond what is considered necessary by tradition, or at least the convention of what David Harvey calls “embedded liberalism” (11). As Anne Helen Peterson wrote in a recent Buzzfeed article,even the trends millennials have popularized — like athleisure — speak to our self-optimization. Yoga pants might look sloppy to your mom, but they’re efficient: you can transition seamlessly from an exercise class to a Skype meeting to child pickup. We use Fresh Direct and Amazon because the time they save allows us to do more work. (Peterson)For the work-martyr, activity in its broadest Aristotelian sense is evaluated by and subordinated to the question of efficiency and productivity. Occupations of time that were once considered external to “work” as matters of “life” (to use Kathi Weeks’s vocabulary) are reconceived as waste when not deployed in the service of value-generation (Weeks 15).The point here, then, is to provide some answers for why the decrease in socially-necessary labour time in an age of automation has not coincided with the Thompsonian expansion of free time. The current dilemma of the neoliberal “work-martyr” is traceable to the political responses generated by crises in production during the depression and the stagflationary disaccumulation of the 1960s-70s, and the major victory in the “battle for ideas” was the transformation of the political subject into human capital. This “intensely constructed and governed” suite of possible values is tasked, according to Wendy Brown, “with improving and leveraging its competitive positioning and with enhancing its (monetary and nonmonetary) portfolio value across all of its endeavours and ventures” (Brown 10). Connecting the creation of this subject in relation to personal or free time is important partly because of time’s longstanding importance to philosophies of subjectivity. But more to the point, the focus on time is important because it serves to demonstrate the economic foundations of the incursion of capitalist governance into the most private domains of existence. Against the criticism of Marx’s ‘abstract’ theory of value, one can see that the laws of capitalist accumulation make their mark in all parts of contemporary human being, including temporality. By tracing the emergence of afterwork as the unpaid continuation of the accumulation of value, one can show how each subject increasingly ‘lives’ capital. This marks a turning point in political economy. When work spills over a temporal limit, its relationship to reproduction is finally blurred to the point of indistinction. What this means for value-creation in 2019 is something in urgent need of critique.State ReproductionAccording to the Marxian theory, labour’s minimum cost is abstractly determined by the price of the labourer’s necessities. Once they have produced enough objects of value to cover these costs, the rest of their work is surplus value in the hands of the capitalist. The capitalist’s aim, then, is to extend the overall working-day for as long beyond the minimum as possible. Theoretically, the full 24 hours of the day may be used. The rise of machine production in the 19th century allowed the owners to make this theory a reality. The only thing that governed the extension of work-time was the physical minimum of labour-power’s reproduction (Marx 161). But this was on the provision that all the labourer’s “free” time was to be spent regrouping their energies. Anything in excess of this was a privilege: time wasted that could have been spent in the factory. “If the labourer consumes his disposable time for himself”, says Marx, “he robs the capitalist” (162).This began to change with the socialisation of the work process and the increase in technical proficiency that labour demanded in early 20th-century industry. With the changes in the sophistication of the manufacture process, the labourer came to be factored in the production process less as an “appendage of the machine” and more as a collection of decisive skills. Fordism based itself around the recognition that capital itself was “dependent on a family-based reproduction” (Weeks 27). In Ford’s America, the sense that work’s intensity might supplant losses in the working day propelled owners of production to recognise the economic need of ensuring a robust culture of social reproduction. In capital’s original New Deal, Ford provided an increase in wages (the Five Dollar Day) in exchange for a rise in productivity (Dalla Costa v). To preserve the increased rhythm of industrial production required more than a robust wage, however. It required “the formation of a physically efficient and psychologically disciplined working class” (Dalla Costa 2). Companies began to hire sociologists to investigate how workers spent their spare time (Dalla Costa 8). They led the charge in a what we might call the first “anthropological revolution” of the American 20th century, whereby the improved wage of the worker was underpinned by the economisation of their reproduction. This was enabled by the cheapening of social necessities (and thus a reduction in socially-necessary labour time) in profound connection to the development of household economy on the backs of unpaid female labour (Weeks 25).This arrangement between capital and labour persisted until 1929. When the inevitable crisis came, however, wages faltered, and many workers joined the ranks of the unemployed. Unable to afford even the basics of their own reproduction, the working-class looked to the state. They created political and social pressure through marches, demonstrations, attacks on shops and the looting of supply trucks (Dalla Costa 40). The state held out against them, but the crisis in production eventually reached such a point of intensity that the government was forced to intervene. Hoover instituted the Emergency Relief Act and Financial Reconstruction Corporation in 1932. This was expanded the following year by FDR’s New Deal, transforming Emergency Relief into a federal institution and creating the Civil Works Association to stimulate the job market (Dalla Costa 63). The security of the working class was decisively linked to the state through the wage guarantees, welfare measures and even the legal guarantee of collective bargaining.For the most part, the state’s intervention in social reproduction took the pressure off industry by ensuring that the workforce would remain able to handle its burdens and that the unemployed would remain employable. It guaranteed a minimum wage for the employed to ensure that demand didn’t collapse, and provided care outside the workforce to women, children and the elderly.Once the state took responsibility for reproduction, however, it immediately became interested in how free time could be made efficient and cost effective. Abroad, they noted the example of European statist and corporativist approaches. Roosevelt sent a delegation to Europe to study the various measures taken by fascist and United Front governments to curb the effects of economic crisis (Dogliani 247). Among these was Mussolini’s OND (Opera Nazionale Dopolavoro) which sought to accumulate the free time of workers to the ends of production. Part of this required the responsibilisation of the broader community not only for regeneration of labour-power but the formation of a truly fascist political subject.FDR’s social reform program was able to reproduce this at home by following the example of workers’ community organisation during the depression years. Throughout the early ‘30s, self-help cooperatives, complete with “their own systems of payment in goods or currency” emerged among the unemployed (Dalla Costa 61). Black markets in consumer goods and informal labour structures developed in all major cities (Dalla Costa 34). Subsistence goods were self-produced in a cottage industry of unpaid domestic labour by both men and women (Dalla Costa 71). The paragon of self-reproducing communities was urbanised black Americans, whose internal solidarity had saved lives throughout the depression. The state took notice of these informal economies of production and reproduction, and started to incorporate the possibility of community engineering into their national plan. Roosevelt convened the Civilian Conservation Corps to absorb underemployed elements of the American workforce and recover consumer demand through direct state sponsorship (wages) (Dogliani, 247). The Committee of Industrial Organisation was transformed into a “congress” linking workers directly to the state (Dalla Costa 74). Minium wages were secured in the supreme court in 1937, then hiked in 1938 (78). In all, the state emerged at this time as a truly corporativist entity- the guarantor of employment and of class stability. From Social Reproduction to Human Capital InvestmentSo how do we get from New Deal social engineering to yoga pants? The answer is deceptively simple. The state transformed social reproduction into a necessary part of the production process. But this also meant that it was instrumentalised. The state only had to fund its workforce’s reproduction so long as this guaranteed productivity. After the war, this was maintained by a form of “embedded liberalism” which sought to provide full employment, economic growth and welfare for its citizens while anchoring the international economy in the Dollar’s gold-value. However, by providing stable increases in “relative value” (wages), this form of state investment incentivised capital flight and its spectacular consequent: deindustrialisation. The “embedded liberalism” of the state-capital-labour compromise began to breakdown with a new crisis of accumulation (Harvey 11-12). The relocation of production to non-union states and decolonised globally-southern sites of hyper-exploitation led to an ‘urban crisis’ in the job market. But as capitalist expansion carried on abroad, inflation kept dangerous pace with the rate of unemployment. This “stagflation” put irresistible pressure on the post-war order. The Bretton-Woods policy of maintaining fixed interest rates while pinning the dollar to gold was abandoned in 1971 and exchange rates were floated all over the world (Harvey 12). The spectre of a new crisis loomed, but one which couldn’t be resolved by the simple state sponsorship of production and reproduction.While many solutions were offered in place of this, one political vision singled out the state’s intervention into reproduction as the cause of the crisis. The ‘neoliberal’ political revolution began at the level of individual groups of capitalist agitants seeking governmental influence in a crusade against communism. It was given its first run on the historical pitch in Chile as part of the CIA-sponsored Pinochet revanchism, and then imported to NYC to deal with the worsening urban crisis of the 1970s. Instead of focusing on production (which required state intervention to proceed without crisis), neoliberal theory promulgated a turn to monetisation and financialisation. The rule of the New York banks after they forced the City into near-bankruptcy in 1975 prescribed total austerity in order to make good on its debts. The government was forced by capital itself to withdraw from investment in the reproduction of its citizens and workers. This was generalised to a federal policy as Reagan sought to address the decades-long deficit during the early years of his presidential term. Facilitating the global flow of finance and the hegemony of supranational institutions like the IMF, the domestic labour force now became beholden to an international minimum of socially-necessary labour time. At the level of domestic labour, the reduction of labour’s possible cost to this minimum had dramatic consequences. International competition allowed the physical limitations of labour to, once again, vanish from sight. Removed from the discourse of reproduction rights, the capitalist edifice was able to focus on changing the ratio of socially necessary labour to surplus. The mechanism that enabled them to do so was competition among the workforce. With the opening of the world market, capital no longer had to worry about the maintenance of domestic demand.But competition was not sufficient to pull off so grand a feat. What was required was a broader “battle of ideas”; the second anthropological revolution of the American century. The protections that workers had relied upon since the Fordist compromise and the corporativist solution eroded as the new “class-power” of the bourgeoisie levelled neoliberal assaults against associated labour (Harvey 23). While unions were gradually disempowered to fight the inevitable tide of deindustrialisation and capital flight, individual workers were coddled by a stream of neoliberal propaganda promising “Freedom” to those who would leave the stifling atmosphere of collective association. The success of this double enervation crippled union power, and the capitalist could rely increasingly on internal workplace wage stratification to regulate labour at an enterprise level (Dalla Costa 25). Incentive structures transformed labour rights into privileges; imagining old entitlements as concessions from above. In the last thirty years, the foundation of worker protections at large has, according to Brown, become illegible (Brown 38).Time and ValueThe reduction of time needed to produce has not coincided with an expansion of free time. The neoliberal anthropological revolution has wormed its way into the depth of the individual subject’s temporalising through a dual assault on labour conditions and propaganda. The privatisation of reproduction means that its necessary minimum is once again the subject of class struggle. Time spent unproductively outside the workplace now not only robs the capitalist, but the worker. If an activity isn’t a means to increase one’s “experience” (the vector of employability), it is time poorly spent. The likelihood of being hired for a job, in professional industries especially, is dependent on your ability to outperform others not only in your talents and skills, but in your own exploitability. Brown points out that the groups traditionally defined by the “middle strata … works more hours for less pay, fewer benefits, less security, and less promise of retirement or upward mobility than at any time in the past century” (Brown 28-29).This is what is meant by the transformation of workers into ‘human capital’. As far as the worker is concerned, the capitalist no longer purchases their labour-power: they purchase the sum of their experiences and behaviours. A competitive market has emerged for these personality markers. As a piece of human capital, one must expend one’s time not only in reproduction, but the production of their own surplus value. Going to a play adds culture points to your brand; speaking a second language gives you a competitive edge; a robust Instagram following is the difference between getting or missing out on a job. For Jess Whyte, this means that the market is now able to govern in place of the state. It exercises a command over people’s lives in and out of the workplace “which many an old tyrannical state would have envied” (Whyte 20).There is a question here of change and continuity. A survey of the 20th century shows that the reduction of ‘socially necessary labour time’ does not necessarily mean a reduction in time spent at work. In fact, the minimum around which capitalist production circulates is not worktime but wages. It is only at the political level that the working class prevented capital from pursuing this minimum. With the political victory of neoliberalism as a “restoration of class power” to the bourgeoisie, however, this minimum becomes a factor at the heart of all negotiations between capital and labour. The individual labourer lying at the heart of the productive process is reduced to his most naked form: human capital. This capital must spend all its time productively for its own benefit. Mundane tasks are avoidable, as stipulated by the piece of human capital sometimes known as Anne Helen Peterson, if they “wouldn’t make my job easier or my work better”. People are never really after-work under neoliberalism; their spare time is structurally adjusted into auxiliary labour. Competition has achieved what the state could never have dreamed of: a total governance of spare hours. This governance unites journalists tweeting from bed with Amazon workers living where they work, not to mention early-career academics working over a weekend to publish an article in an online journal that is not even paying them. These are all ways in which the privatisation of social reproduction transforms afterwork into unpaid overtime.ReferencesBrown, Wendy. Undoing the Demos: Neoliberalism’s Stealth Revolution. New York: Zone Books, 2015.Dalla Costa, Maria. Family, Welfare, and the State: Between Progressivism and the New Deal. Brooklyn: Common Notions, 2015.Harvey, David. A Brief History of Neoliberalism. Oxford: Oxford UP, 2005.Engels, Friedrich, and Karl Marx. The Marx-Engels Reader. Ed. R.C. Tucker. New York: Norton, 1978.Marx, Karl. Capital: A Critical Analysis of Capitalist Production. Vol. 1 and 2. Trans. E. Aveling and E. Untermann. Hertfordshire: Wordsworth Classics of World Literature, 2013.Peterson, Anne Helen. “How Millennials Became the Burnout Generation.” Buzzfeed. 10 Oct. 2019 <https://www.buzzfeednews.com/article/annehelenpetersen/millennials-burnout-generation-debt-work>.Postone, Moishe. Time, Labour and Social Domination. Cambridge: Cambridge UP, 1993.Thompson, E.P. “Time, Work-Discipline, and Industrial Capitalism.” In Stanley Aronowitz and Michael J. Roberts, eds., Class: The Anthology. Hoboken: Wiley, 2018.Wang, Jackie. Carceral Capitalism. Los Angeles: Semiotext(e), 2018.Weeks, Kathi. The Problem with Work: Feminism, Marxism, Antiwork Politics, and Postwork Imaginaries. Durham: Duke UP, 2011.Whyte, Jessica. “The Invisible Hand of Friedrich Hayek: Submission and Spontaneous Order.” Political Theory (2017): 1-29.

Abstract:

As the name suggests, the humanities is largely a study of the human condition, in which history sits as a discipline concerned with the past. Environmental history is a new field that brings together scholars from a range of disciplines to consider the changing relationships between humans and the environment over time. Critiques of anthropocentrism that place humans at the centre of the universe or make assessments through an exclusive human perspective provide a challenge to scholars to rethink our traditional biases against the nonhuman world. The movement towards nonhumanism or posthumanism, however, does not seem to have had much of an impression on history as a discipline. What would a nonhumanist history look like if we re-centred the historical narrative around pigs? There are histories of pigs as food (see for example, The Cambridge History of Food which has a chapter on “Hogs”). There are food histories that feature pork in terms of its relationship to multiethnic identity (such as Donna Gabaccia’s We Are What We Eat) and examples made of pigs to promote ethical eating (Singer). Pigs are central to arguments about dietary rules and what motivates them (Soler; Dolander). Ancient pig DNA has also been employed in studies on human migration and colonisation (Larson et al.; Durham University). Pigs are also widely used in a range of products that would surprise many of us. In 2008, Christien Meindertsma spent three years researching the products made from a single pig. Among some of the more unexpected results were: ammunition, medicine, photographic paper, heart valves, brakes, chewing gum, porcelain, cosmetics, cigarettes, hair conditioner and even bio diesel. Likewise, Fergus Henderson, who coined the term ‘nose to tail eating’, uses a pig on the front cover of the book of that name to suggest the extraordinary and numerous potential of pigs’ bodies. However, my intention here is not to pursue a discussion of how parts of their bodies are used, rather to consider a reorientation of the historical narrative to place pigs at the centre of stories of our co-evolution, in order to see what their history might say about humans and our relationships with them. This is underpinned by recognition of the inter-relationality of humans and animals. The relationships between wild boar and pigs with humans has been long and diverse. In a book exploring 10,000 years of interaction, Anton Ervynck and Peter Rowley-Conwy argue that pigs have been central to complex cultural developments in human societies and they played an important role in human migration patterns. The book is firmly grounded within the disciplines of zoology, anthropology and archaeology and contributes to an understanding of the complex and changing relationship humans have historically shared with wild boar and domestic pigs. Naturalist Lyall Watson also explores human/pig relationships in The Whole Hog. The insights these approaches offer for the discipline of history are valuable (although overlooked) but, more importantly, such scholarship also challenges a humanist perspective that credits humans exclusively with historical change and suggests, moreover, that we did it alone. Pigs occupy a special place in this history because of their likeness to humans, revealed in their use in transplant technology, as well as because of the iconic and paradoxical status they occupy in our lives. As Ervynck and Rowley-Conwy explain, “On the one hand, they are praised for their fecundity, their intelligence, and their ability to eat almost anything, but on the other hand, they are unfairly derided for their apparent slovenliness, unclean ways, and gluttonous behaviour” (1). Scientist Niamh O’Connell was struck by the human parallels in the complex social structures which rule the lives of pigs and people when she began a research project on pig behaviour at the Agricultural Research Institute at Hillsborough in County Down (Cassidy). According to O’Connell, pigs adopt different philosophies and lifestyle strategies to get the most out of their life. “What is interesting from a human perspective is that low-ranking animals tend to adopt one of two strategies,” she says. “You have got the animals who accept their station in life and then you have got the other ones that are continually trying to climb, and as a consequence, their life is very stressed” (qtd. in Cassidy). The closeness of pigs to humans is the justification for their use in numerous experiments. In the so-called ‘pig test’, code named ‘Priscilla’, for instance, over 700 pigs dressed in military uniforms were used to study the effects of nuclear testing at the Nevada (USA) test site in the 1950s. In When Species Meet, Donna Haraway draws attention to the ambiguities and contradictions promoted by the divide between animals and humans, and between nature and culture. There is an ethical and critical dimension to this critique of human exceptionalism—the view that “humanity alone is not [connected to the] spatial and temporal web of interspecies dependencies” (11). There is also that danger that any examination of our interdependencies may just satisfy a humanist preoccupation with self-reflection and self-reproduction. Given that pigs cannot speak, will they just become the raw material to reproduce the world in human’s own image? As Haraway explains: “Productionism is about man the tool-maker and -user, whose highest technical production is himself […] Blinded by the sun, in thrall to the father, reproduced in the sacred image of the same, his rewards is that he is self-born, an auto telic copy. That is the mythos of enlightenment and transcendence” (67). Jared Diamond acknowledges the mutualistic relationship between pigs and humans in Guns, Germs and Steel and the complex co-evolutionary path between humans and domesticated animals but his account is human-centric. Human’s relationships with pigs helped to shape human history and power relations and they spread across the world with human expansion. But questioning their utility as food and their enslavement to this cause was not part of the account. Pigs have no voice in the histories we write of them and so they can appear as passive objects in their own pasts. Traces of their pasts are available in humanity’s use of them in, for example, the sties built for them and the cooking implements used to prepare meals from them. Relics include bones and viruses, DNA sequences and land use patterns. Historians are used to dealing with subjects that cannot speak back, but they have usually left ample evidence of what they have said. In the process of writing, historians attempt to perform the miracle, as Curthoys and Docker have suggested, of restoration; bringing the people and places that existed in the past back to life (7). Writing about pigs should also attempt to bring the animal to life, to understand not just their past but also our own culture. In putting forward the idea of an alternative history that starts with pigs, I am aware of both the limits to such a proposal, and that most people’s only contact with pigs is through the meat they buy at the supermarket. Calls for a ban on intensive pig farming (RSPCA, ABC, AACT) might indeed have shocked people who imagine their dinner comes from the type of family farm featured in the movie Babe. Baby pigs in factory farms would have been killed a long time before the film’s sheep dog show (usually at 3 to 4 months of age). In fact, because baby pigs do grow so fast, 48 different pigs were used to film the role of the central character in Babe. While Babe himself may not have been aware of the relationship pigs generally have to humans, the other animals were very cognisant of their function. People eat pigs, even if they change the name of the form it takes in order to do so:Cat: You know, I probably shouldn’t say this, but I’m not sure if you realize how much the other animals are laughing at you for this sheep dog business. Babe: Why would they do that? Cat: Well, they say that you’ve forgotten that you’re a pig. Isn't that silly? Babe: What do you mean? Cat: You know, why pigs are here. Babe: Why are any of us here? Cat: Well, the cow’s here to be milked, the dogs are here to help the Boss's husband with the sheep, and I’m here to be beautiful and affectionate to the boss. Babe: Yes? Cat: [sighs softly] The fact is that pigs don’t have a purpose, just like ducks don’t have a purpose. Babe: [confused] Uh, I—I don’t, uh ... Cat: Alright, for your own sake, I’ll be blunt. Why do the Bosses keep ducks? To eat them. So why do the Bosses keep a pig? The fact is that animals don’t seem to have a purpose really do have a purpose. The Bosses have to eat. It’s probably the most noble purpose of all, when you come to think about it. Babe: They eat pigs? Cat: Pork, they call it—or bacon. They only call them pigs when they’re alive (Noonan). Babe’s transformation into a working pig to round up the sheep makes him more useful. Ferdinand the duck tried to do the same thing by crowing but was replaced by an alarm clock. This is a common theme in children’s stories, recalling Charlotte’s campaign to praise Wilbur the pig in order to persuade the farmer to let him live in E. B. White’s much loved children’s novel, Charlotte’s Web. Wilbur is “some pig”, “terrific”, “radiant” and “humble”. In 1948, four years before Charlotte’s Web, White had published an essay “Death of a Pig”, in which he fails to save a sick pig that he had bought in order to fatten up and butcher. Babe tried to present an alternative reality from a pig’s perspective, but the little pig was only spared because he was more useful alive than dead. We could all ask the question why are any of us here, but humans do not have to contemplate being eaten to justify their existence. The reputation pigs have for being filthy animals encourages distaste. In another movie, Pulp Fiction, Vincent opts for flavour, but Jules’ denial of pig’s personalities condemns them to insignificance:Vincent: Want some bacon? Jules: No man, I don’t eat pork. Vincent: Are you Jewish? Jules: Nah, I ain’t Jewish, I just don’t dig on swine, that’s all. Vincent: Why not? Jules: Pigs are filthy animals. I don’t eat filthy animals. Vincent: Bacon tastes gooood. Pork chops taste gooood. Jules: Hey, sewer rat may taste like pumpkin pie, but I’d never know ’cause I wouldn’t eat the filthy motherf*cker. Pigs sleep and root in sh*t. That’s a filthy animal. I ain’t eat nothin’ that ain’t got sense enough to disregard its own feces [sic]. Vincent: How about a dog? Dogs eats its own feces. Jules: I don’t eat dog either. Vincent: Yeah, but do you consider a dog to be a filthy animal? Jules: I wouldn’t go so far as to call a dog filthy but they’re definitely dirty. But, a dog’s got personality. Personality goes a long way. Vincent: Ah, so by that rationale, if a pig had a better personality, he would cease to be a filthy animal. Is that true? Jules: Well we’d have to be talkin’ about one charming motherf*ckin’ pig. I mean he’d have to be ten times more charmin’ than that Arnold on Green Acres, you know what I’m sayin’? In the 1960s television show Green Acres, Arnold was an exceptional pig who was allowed to do whatever he wanted. He was talented enough to write his own name and play the piano and his attempts at painting earned him the nickname “Porky Picasso”. These talents reflected values that are appreciated, and so he was. The term “pig” is, however, chiefly used a term of abuse, however, embodying traits we abhor—gluttony, obstinence, squealing, foraging, rooting, wallowing. Making a pig of yourself is rarely honoured. Making a pig of the humanities, however, could be a different story. As a historian I love to forage, although I use white gloves rather than a snout. I have rubbed my face and body on tree trunks in the service of forestry history and when the temperature rises I also enjoy wallowing, rolling from side to side rather than drawing a conclusion. More than this, however, pigs provide a valid means of understanding key historical transitions that define modern society. Significant themes in modern history—production, religion, the body, science, power, the national state, colonialism, gender, consumption, migration, memory—can all be understood through a history of our relationships with pigs. Pigs play an important role in everyday life, but their relationship to the economic, social, political and cultural matters discussed in general history texts—industrialisation, the growth of nation states, colonialism, feminism and so on—are generally ignored. However “natural” this place of pigs may seem, culture and tradition profoundly shape their history and their own contribution to those forces has been largely absent in history. What, then, would the contours of such a history that considered the intermeshing of humans and pigs look like? The intermeshing of pigs in early human history Agricultural economies based on domestic animals began independently in different parts of the world, facilitating increases in population and migration. Evidence for long-term genetic continuity between modern and ancient Chinese domestic pigs has been established by DNA sequences. Larson et al. have made an argument for five additional independent domestications of indigenous wild boar populations: in India, South East Asia and Taiwan, which they use to develop a picture of both pig evolution and the development and spread of early farmers in the Far East. Domestication itself involves transformation into something useful to animals. In the process, humans became transformed. The importance of the Fertile Crescent in human history has been well established. The area is attributed as the site for a series of developments that have defined human history—urbanisation, writing, empires, and civilisation. Those developments have been supported by innovations in food production and animal husbandry. Pig, goats, sheep and cows were all domesticated very early in the Fertile Crescent and remain four of the world’s most important domesticated mammals (Diamond 141). Another study of ancient pig DNA has concluded that the earliest domesticated pigs in Europe, believed to be descended from European wild boar, were introduced from the Middle East. The research, by archaeologists at Durham University, sheds new light on the colonisation of Europe by early farmers, who brought their animals with them. Keith Dobney explains:Many archaeologists believe that farming spread through the diffusion of ideas and cultural exchange, not with the direct migration of people. However, the discovery and analysis of ancient Middle Eastern pig remains across Europe reveals that although cultural exchange did happen, Europe was definitely colonised by Middle Eastern farmers. A combination of rising population and possible climate change in the ‘fertile crescent’, which put pressure on land and resources, made them look for new places to settle, plant their crops and breed their animals and so they rapidly spread west into Europe (ctd in ScienceDaily). Middle Eastern farmers colonised Europe with pigs and in the process transformed human history. Identity as a porcine theme Religious restrictions on the consumption of pigs come from the same area. Such restrictions exist in Jewish dietary laws (Kashrut) and in Muslim dietary laws (Halal). The basis of dietary laws has been the subject of much scholarship (Soler). Economic and health and hygiene factors have been used to explain the development of dietary laws historically. The significance of dietary laws, however, and the importance attached to them can be related to other purposes in defining and expressing religious and cultural identity. Dietary laws and their observance may have been an important factor in sustaining Jewish identity despite the dispersal of Jews in foreign lands since biblical times. In those situations, where a person eats in the home of someone who does not keep kosher, the lack of knowledge about your host’s ingredients and the food preparation techniques make it very difficult to keep kosher. Dietary laws require a certain amount of discipline and self-control, and the ability to make distinctions between right and wrong, good and evil, pure and defiled, the sacred and the profane, in everyday life, thus elevating eating into a religious act. Alternatively, people who eat anything are often subject to moral judgments that may also lead to social stigmatisation and discrimination. One of the most powerful and persuasive discourses influencing current thinking about health and bodies is the construction of an ‘obesity epidemic’, critiqued by a range of authors (see for example, Wright & Harwood). As omnivores who appear indiscriminate when it comes to food, pigs provide an image of uncontrolled eating, made visible by the body as a “virtual confessor”, to use Elizabeth Grosz’s term. In Fat Pig, a production by the Sydney Theatre Company in 2006, women are reduced to being either fat pigs or shrieking shallow women. Fatuosity, a blog by PhD student Jackie Wykes drawing on her research on fat and sexual subjectivity, provides a review of the play to describe the misogyny involved: “It leaves no options for women—you can either be a lovely person but a fat pig who will end up alone; or you can be a shrill bitch but beautiful, and end up with an equally obnoxious and shallow male counterpart”. The elision of the divide between women and pigs enacted by such imagery also creates openings for new modes of analysis and new practices of intervention that further challenge humanist histories. Such interventions need to make visible other power relations embedded in assumptions about identity politics. Following the lead of feminists and postcolonial theorists who have challenged the binary oppositions central to western ideology and hierarchical power relations, critical animal theorists have also called into question the essentialist and dualist assumptions underpinning our views of animals (Best). A pig history of the humanities might restore the central role that pigs have played in human history and evolution, beyond their exploitation as food. Humans have constructed their story of the nature of pigs to suit themselves in terms that are specieist, racist, patriarchal and colonialist, and failed to grasp the connections between the oppression of humans and other animals. The past and the ways it is constructed through history reflect and shape contemporary conditions. In this sense, the past has a powerful impact on the present, and the way this is re-told, therefore, also needs to be situated, historicised and problematicised. The examination of history and society from the standpoint of (nonhuman) animals offers new insights on our relationships in the past, but it might also provide an alternative history that restores their agency and contributes to a different kind of future. As the editor of Critical Animals Studies, Steve Best describes it: “This approach, as I define it, considers the interaction between human and nonhuman animals—past, present, and future—and the need for profound changes in the way humans define themselves and relate to other sentient species and to the natural world as a whole.” References ABC. “Changes to Pig Farming Proposed.” ABC News Online 22 May 2010. 10 Aug. 2010 http://www.abc.net.au/news/stories/2010/05/22/2906519.htm Against Animal Cruelty Tasmania. “Australia’s Intensive Pig Industry: The Intensive Pig Industry in Australia Has Much to Hide.” 10 Sep. 2010 http://www.aact.org.au/pig_industry.htm Babe. Dir. Chris Noonan. Universal Pictures, 1995. Best, Steven. “The Rise of Critical Animal Studies: Putting Theory into Action and Animal Liberation into Higher Education.” Journal for Critical Animal Studies 7.1 (2009): 9-53. Cassidy, Martin. “How Close are Pushy Pigs to Humans?”. BBC News Online 2005. 10 Sep. 2010 http://news.bbc.co.uk/2/hi/uk_news/northern_ireland/4482674.stmCurthoys, A., and Docker, J. “Time Eternity, Truth, and Death: History as Allegory.” Humanities Research 1 (1999) 10 Sep. 2010 http://www.anu.edu.au/hrc/publications/hr/hr_1_1999.phpDiamond, Jared. Guns, Germs and Steel: The Fates of Human Societies. New York: W. W. Norton, 1999. Dolader, Miguel-Àngel Motis. “Mediterranean Jewish Diet and Traditions in the Middle Ages”. Food: A Culinary History. Eds. Jean-Louis Flandrin and Massimo Montanari. Trans. Clarissa Botsford, Arthus Golhammer, Charles Lambert, Frances M. López-Morillas and Sylvia Stevens. New York: Columbia UP, 1999. 224-44. Durham University. “Chinese Pigs ‘Direct Descendants’ of First Domesticated Breeds.” ScienceDaily 20 Apr. 2010. 29 Aug. 2010 http://www.sciencedaily.com/releases/2010/04/100419150947.htm Gabaccia, Donna R. We Are What We Eat: Ethnic Food and the Making of Americans. Cambridge: Harvard University Press, 1998. Grosz, Elizabeth. Volatile Bodies: Toward a Corporeal Feminism. St Leonards: Allen & Unwin, 1994. Haraway, D. “The Promises of Monsters: A Regenerative Politics for Inappropriate/d Others.” The Haraway Reader. New York: Routledge, 2005. 63-124. Haraway, D. When Species Meet: Posthumanities. 3rd ed. London: University of Minnesota Press, 2008. Henderson, Fergus. Nose to Tail Eating: A Kind of British Cooking. London: Bloomsbury, 2004. Kiple, Kenneth F., Kriemhild Coneè Ornelas. Cambridge History of Food. Cambridge: Cambridge University Press, 2000. Larson, G., Ranran Liu, Xingbo Zhao, Jing Yuan, Dorian Fuller, Loukas Barton, Keith Dobney, Qipeng Fan, Zhiliang Gu, Xiao-Hui Liu, Yunbing Luo, Peng Lv, Leif Andersson, and Ning Li. “Patterns of East Asian Pig Domestication, Migration, and Turnover Revealed by Modern and Ancient DNA.” Proceedings of the National Academy of Sciences, United States 19 Apr. 2010. 10 Sep. 2010 http://www.pnas.org/cgi/content/full/0912264107/DCSupplemental Meindertsma, Christien. “PIG 05049. Kunsthal in Rotterdam.” 2008. 10 Sep. 2010 http://www.christienmeindertsma.com/index.php?/books/pig-05049Naess, A. “The Shallow and the Deep, Long-Range Ecology Movement.” Inquiry 16 (1973): 95-100. Needman, T. Fat Pig. Sydney Theatre Company. Oct. 2006. Noonan, Chris [director]. “Babe (1995) Memorable Quotes”. 10 Sep. 2010 http://www.imdb.com/title/tt0112431/quotes Plumwood, V. Feminism and the Mastery of Nature. London: Routledge, 1993. Pulp Fiction. Dir. Quentin Tarantino. Miramax, 1994. RSPCA Tasmania. “RSPCA Calls for Ban on Intensive Pig Farming.” 10 Sep. 2010 http://www.rspcatas.org.au/press-centre/rspca-calls-for-a-ban-on-intensive-pig-farming ScienceDaily. “Ancient Pig DNA Study Sheds New Light on Colonization of Europe by Early Farmers” 4 Sep. 2007. 10 Sep. 2010 http://www.sciencedaily.com/releases/2007/09/070903204822.htm Singer, Peter. “Down on the Family Farm ... or What Happened to Your Dinner When it was Still an Animal.” Animal Liberation 2nd ed. London: Jonathan Cape, 1990. 95-158. Soler, Jean. “Biblical Reasons: The Dietary Rules of the Ancient Hebrews.” Food: A Culinary History. Eds. Jean-Louis Flandrin and Massimo Montanari. Trans. Clarissa Botsford, Arthus Golhammer, Charles Lambert, Frances M. López-Morillas and Sylvia Stevens. New York: Columbia University Press, 1999. 46-54. Watson, Lyall. The Whole Hog: Exploring the Extraordinary Potential of Pigs. London: Profile, 2004. White, E. B. Essays of E. B. White. London: HarperCollins, 1979. White, E. B. Charlotte’s Web. London: HarperCollins, 2004. Wright, J., and V. Harwood. Eds. Biopolitics and the ‘Obesity Epidemic’. New York: Routledge, 2009. Wykes, J. Fatuosity 2010. 29 Aug. 2010 http://www.fatuosity.net